2. An enhancer, located upstream from a gene, has the following sequence: 5' – GTAG – 3' 3'- САТС - 5' The enhancer is orientation-independent. Which of the following sequences also work(s) as enhancer? Why not others? (Only the top strand is shown; the sequence and polarity of the bottom strand can be inferred.) а. 5'- СТАС -3' b. 5' – GATG 3' с. 5'- САТС -3' с. 5'- GTTC -3'

2. An enhancer, located upstream from a gene, has the following sequence: 5' – GTAG – 3' 3'- САТС - 5' The enhancer is orientation-independent. Which of the following sequences also work(s) as enhancer? Why not others? (Only the top strand is shown; the sequence and polarity of the bottom strand can be inferred.) а. 5'- СТАС -3' b. 5' – GATG 3' с. 5'- САТС -3' с. 5'- GTTC -3'

Name: 2. An enhancer, located upstream from a gene, has the following seque
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 2. An enhancer, located upstream from a gene, has the following sequence:5' – GTAG – 3'3'- САТС - 5'The enhancer is orientation-independent. Which of the following sequences also work(s) asenhancer? Why not others? (Only the top strand is shown; the

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter16: Regulation Of Gene Expression

Section: Chapter Questions

Problem 2TYK: For the E. coli lac operon, when lactose is present: a. and glucose is absent, cAMP binds and...

See similar textbooks

Similar questions

1. Draw a diagram of the lac operon. PO I+P+O+Z+Y+ I+P+OcZ+Y- I-P+O+Z+Y+ Lab section (circle): lacz gene lac Y gene lacA gene I+P+O+ZY/IPO+Z+Y- 2. The promoter (P) is the start site of transcription through the binding of RNA polymerase before actual mRNA production. Mutated promoters (P) cannot bind RNA polymerase, so no mRNA is made. In the table below, make predictions about the expression of ß-galactosidase and permease for different partial diploid (F') genotypes. Do this for E. coli growth on two different types of media - one without lactose, and one with. Use a to mark where there is no enzyme produced, and a + to mark where the enzyme is made. The first genotype has all wild-type alleles, and has been filled in as an example. Genotype IPOCZ+Y/I-P+O+Z-Y+ ISP+O+Z+Y/I+P+O+Z*Y* CR 1:00 Lactose absent B-galactosidase Permease R 3:-00 + R 6:30 Lactose present B-galactosidase F 10:00 Permease
3. For this gene (I marked the +1 site) a. Identify the promoter, template, and coding strand b. Transcribe Translate C. 5'- CAAATTAATGGCGGCATTTACGATGGTGGGATCATTACATTGACTAACG -3' 1 5 3'- GTTTAATTACCGCCGTAAATGCTACCACCCTAGTAATGTAACTGATTGC -5′ -+- -+--- --+−−· ---+--
1. A DNA base sequence transcribed into messenger RNA in the following sequence: TTATCTTCGGGAGAGAAAACA. a. If you read from left to right, what amino acids are coded by this sequence? (Note: The initiation sequence is disregarded in this example.) b. If proflavine treatment caused the deletion of the first adenine nucleotide on the left, describe the changes that would occur in the first six amino acids coded by this sequence?
1. Please tell me: What's a mutation in moleculer terms? 2. When a mutation deletes a base in genomic DNA, how does it affect the expression product production and reading frame? 3. How does induction control enzyme synthesis using lactose operon?
20. in differential translation, a different transcript may be recovered depending on which TATA box is used true or false
5. As you know, the lac promoter is a poor intrinsic promoter: it is transcribed efficiently only when CAP-CAMP is bound nearby. Imagine that a culture of E. coli cells is mutagenized and spread on an agar plate containing IPTG, glucose, and X-Gal. Most of the resulting colonies are white but a few are blue. [IPTG is a lactose analog that binds to and inactivates the lac repressor; unlike lactose, IPTG does not require Lac Permease (LacY) to enter the cell. X-gal is a substrate of B-galactosidase that yields a blue product when cleaved by the enzyme; X-gal does not bind to the lac repressor. For the purpose of this problem, assume that anything less than maximal induction of B-galactosidase results in a white colony. (i) Why was it expected that most of the colonies would be white? (ii) Describe two different mutations mapping within protein-coding DNA that can account for the blue colonies. The two mutations should map in different genes and need not map to the lac operon. Name the…
1. The following is the partial DNA sequence of Gene A. Note: The underlined sequence (from position 20-54) represents the promoter for Gene A and the underlined and italicized sequence (from position 71-90 represents the ribosome binding (RBS) site of Gene A. Transcription begins at and includes the bold T/A base pair at position 60. 10 20 30 40 50 60 70 --- 5 ATCGGTCTCGGCTACTACATAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTAGGCTACTAC 3 TAGCCAGAGCCGATGATGTATTTG TATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG Promoter 80 90 100 110 120 130 140 --- 5' СAGGTAТCGGTCTGATСТАССТАGСттстсттстстстстсССССGCGGGGGCTGTACTATCАTGCGTCG 3 GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC RBS 150 160 170 180 190 200 210 --I- - -I- -- 5 TCTCGGCTACTACGTAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTCGGCTACTACGTAAA 3 AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT What are the first 4 amino acids encoded by Gene A? Write the N and C terminal ends. Hint: Find the DNA coding strand,…
4. Shown here is a regulation of a gene a) Is this a prokaryotic or eukaryotic gene? Explain in short b) Which of proteins A, B, or C is likely to have a DNA binding domain? c) Which of proteins A, B, or C is likely to have a transactivation domain? d) What would happen if the majority of DNA between the enhancer and site of RNA pol binding was deleted? RNA Polymerase II- Enhancer B DNA Gene X Expression of Gene X .5' 3'
12. You want to determine the location of the promoter and operator for an operon. To do so, you create the following deletions and assay their phenotype. The thin lines indicate the deleted region. expression d1 inducible inducible d2 d3 constitutive d4 none d5 none d6 inducible Which of the following can you conclude from this data? a. Part of the promoter is within deletion 1 b. Part of the operator is within deletion 3 c. The promoter and the operator are very close to each other d. Both b and c e. Both a and b
8. ----ATTATA-- -ТААТАТ-- Fill in the polarity of the strands? Which strand is the coding strand? Which strand is the template strand? What is the direction of transcription? 9. You have a nucleic acid with the following percentages of bases 1. A=35% G=32% T=8% C=25% II. A=20% G=32% T=18% C=30% III. A=23% G=14% U=42% C=21% For the 3 nucleic acids above, determine whether it is single stranded or double stranded DNA or RNA 10. An RNA molecule has the following percentages of bases A=16% G=27% U=37% C=20% What would be the percentage of bases in the template strand of the DNA that contains the gene for this RNA?
1. Contents of the diagram below was discovered in the 1960s. Explain in detail what this diagram is demonstration and define each component? Where is the CAMP-CRP binding site? Where is the RNA polymerase binding site of the promoter? What is the position of the Transcription start site? Promoter I gene Z gene CAMP-CRP binding site RNA Polymerase binding site Operator MRNA DNA sequence -100-90 一B0 -70 -60 -50一40 -30 -20 -10 +1 +10 十20 小30 +40) MetN -Thr - Met
1. Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds from left to right. 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGACCTAAGC -3' 56 1 11 + ---+--- ----+-- * a. Draw a green box around the promoter. b. Label the template strand of the DNA on the sequence above. C. Write the sequence of the mRNA. Anticodon sequence: --+--- 3'-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTGGATTCG ---+-- -5' d. Write the sequence of the peptide that is translated from the mature mRNA and label the directionality of the peptide. e. Give the sequence (and indicate the directionality) of the anti-codon on the tRNA that inserts the 2nd amino acid into the newly made peptide. f. Imagine that, in the process of DNA replication, the 39th base in the gene (with the *) was changed from A/T to C/G. What would be the effect of this mutation on the produced peptide?