3. Explain the three stages of transcription in Eukaryotic cell. Identify all enzymes used with their corresponding function. Promoter ТАТАAА -30 +1 Transcription start site TEIID TBP +1 Transcription start site TEIIB TEIID TEIIA ТВР +1 Transcription start site TEIE TEIIE TEIIB TEIID TEIIA TEIIH ТВР +1 RNA Polymerase II Transcription start site

Q: Identify the parts of a gene/transcription unit and identify the parts that are transcribed. The…

A: DNA is the nucleic acid that behaves as a carrier of genetic information in almost all biological…

Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…

A: The mutation is the change in the nucleotide sequence of the DNA. The point mutation is the mutation…

Q: In prokaryotes, the promoter contains a -35 and -10 region upstream of the transcription start site.…

A: Promoter is the sequence in DNA where RNA polymerase is recruited. This is present before the…

Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…

A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…

Q: 1.Describe the journey of a protein, from its synthesis to its final destination 2. Explain the…

A: Proteins are essential macromolecules that perform various functions within cells and organisms. The…

Q: Below is a diagram of a gene that is not normally alternatively spliced. All four exons (represented…

A: Transcription is the synthesis of mRNA from the DNA. Northern blotting is used to study the mRNA and…

Q: b. You have found two mutant alleles of Gene A that have insertion of the three base pairs (as shown…

A: DNA is the deoxyribonucleic acid. It is a double-stranded molecule, which consists of two strands:…

Q: A cell that has a mutation that increases the catalytic rate of RNA Polymerase II will likely have…

A: A cell that has a mutation that increases the catalytic rate of RNA Polymerase II will likely have…

Q: 1. Contents of the diagram below was discovered in the 1960s. Explain in detail what this diagram is…

A: Transcription is defined as the process by which the information present in a strand of DNA will be…

Q: Which of the following is/are true regarding transcription initiation in bacteria? I. TFIID will…

A: To start transcribing a gene, RNA polymerase binds to the promoter region of the gene's DNA.... The…

Q: In a couple of sentences, explain how eukaryotic activator proteins (that are usually gene-specific…

A: Transcription factors are proteins that bind to neighbouring DNA and help switch particular genes…

Q: Four terms and statements related to gene regulatlon Match the correct term to each of the four…

A: According to the question, four terms and statements are related to gene regulation in bacteria are…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: 3. Where in the eukaryotic cell does transcription during transcription? occur and what molecule is…

A: Nucleic acid is a macromolecule present inside the nucleus of the cell . In this , genetic material…

Q: A particular mutation in the bacterial sigma factor allows this protein to bind RNA polymerase but…

A: Answer - Option A - It will prevent the transcription termination exerted by the Rho protein

Q: Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds…

A: Gene is present on a chromosome and contains hereditary information. These genes are later…

Q: What conditions would we find on the gene of a prokaryote if there is low amounts of tryptophan…

A: Tryptophan is less common amino acid found in protein. They plays an important role in structural…

Q: 2. The promoter (P) is the start site of transcription through the binding of RNA polymerase before…

A: The lac operon: The lac operon or the lactose operon is the most widely studied gene with respect to…

Q: Please study the diagram above on eukaryotic gene expression. In order to provide instructions for…

A: EXPLANATION : Noncoding DNA is also found within most of the eukaryotic genes. Such genes have a…

Q: III. Discuss the following aspects of translation: 1. How does the location and timing of…

A: According to our guideline we can answer maximum 3 subparts of a question. So, you need to upload…

Q: Draw/Diagram and describe Initiation of Transcription in a typical eukaryote. description should be…

A: Eukaryotes have three types of RNA polymerases, I, II, and III, and prokaryotes only have one type.…

Q: d. Where would you find a mutation that affects transcription of this gene? e. Where would you find…

A: A human gene at molecular level consists of several parts like promoter where the transcription…

Q: 1- How does the sigma factor control whether it can start transcription together to give way to RNA…

A: Transcription is the process where one strand of DNA is transcribed into RNA is known as antisense…

Q: G3A (G at position 3 was changed to A) G9A Deletion of TCA at position 18-20 C22A T31A, A32T double…

A: The Mendelian gene is a basic unit of the heredity and the molecular gene is a sequence of…

Q: Choose all that apply regarding gene transcription in eukaryotes: Multiple transcription factors are…

A: Transcription in eukaryotes.

Q: AUGCCGCAAUCUGUUCACGCACUCAUGUG TII CAC & CACICATETE Direction of synthesis- BTTT ATGCCGCA сш TTT…

A: The term "mRNA" is defined as a single-stranded molecule that carries genetic code from DNA used to…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.