8. ----ATTATA---ТААТАТ--Fill in the polarity of the strands?Which strand is the coding strand?Which strand is the template strand?What is the direction of transcription?9. You have a nucleic acid with the following percentages of bases1. A=35% G=32% T=8% C=25%II. A=20% G=32% T=18% C=30%III.A=23% G=14% U=42% C=21%For the 3 nucleic acids above, determine whether it is single stranded or double stranded DNA or RNA10. An RNA molecule has the following percentages of basesA=16% G=27% U=37% C=20%What would be the percentage of bases in the template strand of the DNA that contains the genefor this RNA?

Name: 8. ----ATTATA---ТААТАТ--Fill in the polarity of the strands?Which str
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 8. ----ATTATA---ТААТАТ--Fill in the polarity of the strands?Which strand is the coding strand?Which strand is the template strand?What is the direction of transcription?9. You have a nucleic acid with the following percentages of bases1. A=35% G=32%

Since you have asked multiple questions, we will solve the first question for you. If you want any…

Answered: 8. ----ATTATA--- ----TAATAT--- Fill in…

Science

Biology

8. ----ATTATA--- ----TAATAT--- Fill in the polarity of the strands? Which strand is the coding strand? Which strand is the template strand? What is the direction of transcription?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 3TYK

See similar textbooks

Related questions

Q: 69. Which of the following statements about RNA splicing is false? A) Introns are not found in…

A: RNA splicing permits numerous functional mRNAs to be produced from a single transcript that codes…

Q: What are the differences between translation and transcription in bacteria and eukaryotes? Give a…

A: Differences: Bacteria…

Q: Which of the following statements regarding complementary molecules in transcription is false?

A: Transcription is the process by which the genetic information encoded in the DNA is copied to the…

Q: What is a disorder caused by errors in transcription? What kind of error is involved?

A: Transcription is defined as the process by which the information present in a DNA strand is copied…

Q: What process would be affected by the lack of the en- zyme RNA polymerase?

A: DNA and RNA are the two types of nucleic acids present in living beings.

Q: Which snRNP leaves in order to form the active spliceosome? OU1 U3 OU4 U2

A: At least five different types of snRNPs join mainly the spliceosome to specifically participate in…

Q: How does the intrinsically disordered C-terminal domain of RNA polymerase II contribute to the…

A: C terminal domain of RNA polymerase II consists of a block of seven amino acids with the consensus…

Q: Is the transcription of RNA from a DNA template perfect?

Q: What happens in the presence of high cellular concentrations of tryptophan? a) tryptophan binds to…

A: Introduction:- Tryptophan is an essential amino acid, a component of proteins necessary for growth.…

Q: 3. Where in the eukaryotic cell does transcription during transcription? occur and what molecule is…

A: Nucleic acid is a macromolecule present inside the nucleus of the cell . In this , genetic material…

Q: Briefly describe three stages of transcription. How is transcription initiated? How is…

A: Transcription the process in which RNA is formed from the DNA that is present in the nucleus of the…

Q: In bacteria, which sequences in the promoter does sigma protein recognize to establish a constant…

A: A promoter is the cis-acting and position-dependent DNA sequence that is necessary for efficient…

Q: What percent of the transcription in a human cell makes protein-coding RNA, and what percent of…

A: The human genome consists of both the regions, which code for proteins and then which do not. The…

Q: Which is the expected outcome following the deacetylation of histones?

A: Ans - a) Coiling of chromatin, preventing it from being accessed by the transcriptional machinery.…

Q: The following diagram represents DNA that is part of the RNA-coding sequence of a transcription…

A: Transcription is a process through which the template strand of DNA transcribes into mRNA with the…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

8. ----ATTATA--
-ТААТАТ--
Fill in the polarity of the strands?
Which strand is the coding strand?
Which strand is the template strand?
What is the direction of transcription?
9. You have a nucleic acid with the following percentages of bases
1. A=35% G=32% T=8% C=25%
II. A=20% G=32% T=18% C=30%
III.
A=23% G=14% U=42% C=21%
For the 3 nucleic acids above, determine whether it is single stranded or double stranded DNA or RNA
10. An RNA molecule has the following percentages of bases
A=16% G=27% U=37% C=20%
What would be the percentage of bases in the template strand of the DNA that contains the gene
for this RNA?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?
1). The sequence of mRNA made using the DNA double helix shown below is 2). The sequence of protein made using the mRNA is
I've attached the table of transcription ans translation for a DNA and Bees work, Genes A and B are exons while C is an intron. Gene A has a silent mutation and Gene B has a nonsense mutation. Please answer the below for me The 3 genes code for different proteins: • Gene A = protein essential for stinger • Gene B = DNA replication enzyme • Gene C = fuzzy hair protein Do you think it matters which protein is mutated? Is one protein more important than another? How would you try to help the bees stay healthy using the information from the mutations?
How are the two poteins different? (see attached images)
What polypeptide would be produced from the following strand of DNA? The first pair of nucleotides (bolded) contains the start point of transcription. Label the C-terminus and N-terminus ends of the polypeptide. 3’-ATGCCTACGGGTACGCCACTACTCCC-5’ 5’-TACCCATGCCCATGCGGTGATGAGGG-3’
Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.
4.) what is the amino acid chain that your answer in item 2 will dictate? Question in Item 2: The complementary strand from item 1 undergoes transcription. What will be its mRNA complementary strand? Answer : The mRNA complementary strand from this complementary strand obtained from item 1 should be:AAGUUUCGCCCCGGG. 5.) Suppose that the amino acid chain in item 4 is altered. In what stage replication, transcription, or translation) could an error have occured? Explain your answer using the template DNA from item 1. Question in item 1 : if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its complementary DNA strand? Answer : According to complementary base pairing rules, A is complementary to T and G is complementary to C. Hence the complementary DNA strand should be:TTCAAAGCGGGGCCC
30)
(1) Give 3 differences between DNA and RNA (2) Give 2 similarities and 2 differences between transcription and replication (3) A DNA strand is 5' TAC ACG GTC TAA3' Write the RNA strand that could be made from the DNA strand. Indicate the 5' and 3' ends For each of the following, say whether they are DNA or protein Enhancer Transcription Factor Promoter RNA polymerase
None
Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 1. In this given DNA, the top strand is the 5' to 3' strand and the bottom strand is the 3' to 5' strand. The bottom strand (3' to 5' strand) acts as the template for transcription. PLEASE EXPLAIN WHY. 2. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript. 3. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. please answer the 3 questions, thank you so much!
The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'