Which snRNP leaves in order to form the active spliceosome? OU1 U3 OU4 U2

Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…

A: The introns are the non-coding parts of the premature mRNA that must be removed by…

Q: What does histone acetylation favor?

A: The DNA (deoxyribonucleic acid) in cell is wrapped around proteins called histones. A DNA segment…

Q: Describe the function of CYP3A4?

A: Answer- CYP3A4 or cytochrome P450 3A4 is a human enzyme that is present and synthesized in the…

Q: What are the role of transcription proteins? Explain briefly at your own words

A: TRANSCRIPTION:-  During the process of gene expression, DNA is first copied into an mRNA molecule…

Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3

A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…

Q: The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb.…

A: Because the gene contains introns (non-coding regions within the gene) that are removed during the…

Q: Describe the structure and function of a spliceosome. Speculate why the spliceosome subunits contain…

A: Splicing is a process during which introns from the pre-RNA is removed and exons are joined…

Q: What does the lacA gene code for?

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH…

A: The template strand extends from 3' to 5'. The coding strand, that extends from 5' to 3' in…

Q: What are histone acetyl transferases (HATs)?

A: Histones are proteins that are associated with DNA inside the nucleus of eukaryotic organisms. The…

Q: What does the White gene code for?

A: Genes are the structural and functional units of heredity that carry coded genetic information in…

Q: In what reactions do mRNA, tRNA, rRNA, and hnRNA participate in and show an illustration for each.

A: Ribonucleic acid is a vital biological macromolecule found in all living organisms. It is primarily…

Q: What is the histone code?

A: The histones are the basic proteins family that are attached to DNA inside the cell. These basic…

Q: What are the two main functions of the APC / cyclosome complex? Describe in detail.

A: The process by which a parent cell divides and forms two daughter cells is referred to as cell…

Q: What happens when a nonsense mutation is introduced into a transposon's gene encoding transposase?

A: A non-sense mutation is a mutation that terminates translation earlier resulting in the formation of…

Q: which exons become spliced together?

A: Splicing is the editing of the nascent precursor messenger ribonucleic acid (RNA) called pre-mRNA…

Q: Translate this RNA sequence into an amino acid sequence: 5'-AUG GGC UAC CGA-3'?

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Which of the following are elongation factors involved in the attachment of new aminoacyl-tRNAs?…

A: During translation protein synthesis occurs from RNA. The sequence of nucleotides in RNA act as code…

Q: If p63 can bind to the same promoter elements as p53, why would it be considered an inhibitor of…

A: Promoters are DNA sequences that function as a kind of "On" switch to start the biological process…

Q: Describe the structure and location of a D-loop.

A: Deoxyribonucleic acid (DNA) is the molecule that holds genetic instructions in all the organisms.…

Q: What is allosteric repressor ?

A: Biology terms are fundamental concepts and terms used in biology, which is the study of life and…

Q: How does KU proteins promote DNA repair during mitosis? Explain.

A: DNA repair  It involves different processes through which a cell determines and rectifies the damage…

Q: Why nonhomologous end-joining (NHEJ) is helpful ?

A: Non-homologous end joining (NHEJ)  Is a repair process for double-strand DNA breaks. In contrast to…

Q: 4. What is the nitrogen base pair of Adenine in transcription? * Cytosine O Uracil O guanine thymine…

A: Nucleic acid is biological macromolecules that is exhibited inside the nucleus is the cell. It…

Q: Which of the events are special and only occur in prophase 1

A: cell cycle is the process by which a cell divided into new daughter cells. meiosis is a type of cell…

Q: _snRNP of the spliceosome recognizes to the 5' splice site through conventional base-pairing. These…

A: Splicing is a process that removes non coding sequence of genes from pre mRNA. Non coding sequence…

Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…

A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…

Q: Given the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid…

A: DNA => Transcription => mRNA => Translation => Protein. Given DNA sequence: 5' ATG CTT…

Q: Put the following steps of transcription in order

A: The Central Dogma Theory is one of the most important concepts in the field of Cell Biology. It…