Suppose multiple mutations occur in the U1 snRNA. Which step in the mRNA Spllcingmechanism would be directly impaired?The second transesterification reaction5' splice site/donor site recognition3' splice site/acceptor site recognitionO Branch site recognition

Name: Suppose multiple mutations occur in the U1 snRNA. Which step in the m
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Suppose multiple mutations occur in the U1 snRNA. Which step in the mRNA Spllcingmechanism would be directly impaired?The second transesterification reaction5' splice site/donor site recognition3' splice site/acceptor site recognitionO Branch site r

The processing of mRNA (messenger ribonucleic acid) includes the addition of a 5’ cap composed of…

Science

Biology

Suppose multiple mutations occur in the U1 snRNA. Which step mechanism would be directly impaired? O The second transesterification reaction 5' splice site/donor site recognition 3' splice site/acceptor site recognition Branch site recognition

Suppose multiple mutations occur in the U1 snRNA. Which step mechanism would be directly impaired? O The second transesterification reaction 5' splice site/donor site recognition 3' splice site/acceptor site recognition Branch site recognition

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Similar questions

Both answer please
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Prokaryotic cells can have more than one functional start codon per mRNA because There are multiple answers A prokaryotic promotes consist of two separated sequences: the -30 box and the -10 box B they make polycistronic RNA C both transcription and translation happen in the same cellular compartment D prokaryotic ribosomes bind to the Shine-Delgarno sequence E the activity of the lac repressor is regulated based on the physiologic condition of the cell
U1 snRNP of the spliceosome bind to the 5' splice site to begin the RNA splicing * True false
Given this mRNA strand: 3’ - AUGAGGAAGGUA - 5’; what are the components of the polypeptide?
RNA polymerase O Transcription to produce pre-mRNA O Post- transcriptional modification Nuclear pore complex OExport of mature mRNA into cytoplasm OPost- Ribosome with transfer RNAS translational O Translation of OProtein folding modifications. mature mRNA Look at the image above: 3. Where does transcription specifically take place in the cell? 4. Where does translation specifically take place in the cell?
Modifications of histone tails can: O repress the transcription of some genes affect chromatin structure affect the transcription of some genes in response to the diet or environment activate the transcription of some genes all of these choices are correct The ferritin gene encodes an IRE (Iron-response element) within the 5 UTR (untranslated region) of the MRNA Considering what you know about eukaryotic translation, the IRE-BP (Iron Response Element Binding Protein) is bound to the IRE in the 5'UTR. you would expect: O That the presence of the IRE-BP would enhance translation. That the presence of the IRE-BP would have no effect. That the presence of the IRE-BP would block translation I don't remember enough about the IRE-BP or transiation to guess. 3 Assuming that the trait represented by the filled symbols in the pedigree is an inherited trait due to a single gene with alleles A and a, what mode of inheritance does the pedigree shown suggest?
The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?
From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expression THERE ARE MULTIPLE ANSWER TO THE QUESTION Group of answer choices A RNA polymerase II B 3' UTR C mediator protein D 5' UTR E activators F coding sequence G specific transcription factors H general transcription factors
Usually found in prokaryotes, regulatory sequences lying adjacent to the DNA being transcribed are composed of a promoter located next to a(n) ____ that interacts and is controlled by regulatory protein. TATA box rho binding domain RNA polymerase holoenzyme operator
if the following DNA sequence were transcribed, which of the following describes the output of this process? 3'- TCTGGACA-5' A. This would produce a protein that looks like 5'- A G A C C U G U -3' B. This would produce a tRNA that looks like 3'- A G AC C U G U -5' C. This would produce an mRNA that looks like this: 5'- A G AC C U G U -3' D. This would produce an mRNA that looks like 3'- U C U G G A CA -5' E. This would produce another strand of DNA that 0ok like 5-AG ACCT GT-3. ..
Shown below is an eukaryotic gene. Assuming normal wild type RNA processing in a.cell, which of the following mature MRNAS could result in normal levels of functional synthesized proteins? Select all that apply Direction of transcription Promoter Template strand 5' Exon 4 Intron 3 Exon 3 Intron 2 Exon 2 Intron 1 Exon 1 3' 5' Coding strand Transcription start Transcription start 5' CAP-Exon1-Exon3-Exon4-AA..AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4-AA...AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4 Exon1-Exon2-Exon3-Exon4-.....AAAA