Usually found in prokaryotes, regulatory sequences lying adjacent to the DNA being transcribed are composed of a promoter located next to a(n) that interacts and is controlled by regulatory protein. A rho binding domain в) ТАТА box C operator D RNA polymerase holoenzyme
Q: The transcription of a gene called YFG (your favoritegene) is activated when three transcription fac...
A: An enhanceosome is a group of trans-acting factors that assemble at an enhancer region of a gene to ...
Q: The interior core of globular proteins is typically composed of non-polar amino acid residues becaus...
A: Proteins are made up of polypeptide chains of amino acids. The amino acids arrange themselves to for...
Q: Double-helical DNA has major and minor grooves because
A: The question is regarding DNA double helix structure. The structure of a DNA molecule is described a...
Q: Dopamine, norepinephrine and epinephrine are collectively called catecholamines. Which of the follow...
A: Catecholamines are group of hormones made by adrenal glands and its is secreted the chromaffin cells...
Q: Show the amount of ATP were produced in beta-oxidation of lauric acid, and differentiate both the GR...
A: Lauric acid has a 12-carbon backbone and is a saturated medium-chain fatty acid. Under anaerobic and...
Q: Linolenic acid and Linoleic acid, the essential fatty acids, are respectively, * A. 16:1 and 18:1 ...
A: Linolenic acid and Linoleic acid:- both are essential fatty acids ( makes hormones, regulate immune ...
Q: Rory’s father was working on the electrical wiring his basement. Rory noticed that his father wore r...
A: Rory's father was wearing rubber gloves, which are known to be one of the defense mechanisms while w...
Q: 25. What would be the new pH of a 1L buffer solution (pH=7.8) upon the addition of 3mL O.0001 M HCI....
A: The new pH of a 1L buffer solution (pH=7.8) upon the addition of 3mL 0.0001 M HCI. (Buffer, pka=7.2)...
Q: Which of the following is correct pairing of concepts? * A. Male sex hormones: androgens B. Preg...
A: Hormones are the body's chemical messengers that travel in our bloodstream to organs, skin, muscles,...
Q: The cofactor shown below: NH2 NH2 он -O- он он 1) is an oxidizing agent O 2) is a reducing agent O 3...
A: A cofactor is a non-protein chemical molecule or metallic ion that is required for an enzyme to perf...
Q: Chapter 15 Reading Question 5
A: The acylation of the three hydroxy groups of glycerol with palmitoleic acid produces 1,2,3-tripalmit...
Q: Show the separation pattern of the following DNA molecules on 1 % agarose gel. Justify your results....
A: Introduction: Agarose gel electrophoresis is a molecular biology technique to analyze and separate ...
Q: How can we use software to identify restriction-enzyme cutting sites in sequenced DNA ?
A: Restriction analysis is the process of identifying restriction mapping sites in DNA sequences by emp...
Q: Enumerate the similarities and the differences of Chlorophyll A and B. Similarities Differences
A: Introduction: Chlorophyll is a natural fat-soluble molecule found in plants that allow plants to con...
Q: When answering the questions below, please use the ONE-LETTER CODE for the amino acid, with NO space...
A: The determination of primary structure of a protein is crucial since the sequence of the protein det...
Q: Eukaryotic RNAs, such as tRNA and rRNA use different RNA Polymerases. True False
A: Eukaryotic transcription:- In Eukaryotes, 3 different kind of RNA polymerase are used.
Q: Which of the following statements is TRUE for nonpolar amino acid residues of polypeptides or protei...
A: They are hydrophilic and found buried within proteins FALSE. Water soluble proteins contain am...
Q: SDS-PAGE reagents that play a role in denaturing the protein sample include (Select all that applies...
A: Proteins are present in their globular structure till they don't get denatured by something extraord...
Q: Question 4 Which is/are NOT true of protein isofor (A They have variable amino acid B They have iden...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: GIVEN: Centrifuge A: rotor radius - 5 cm; max. speed - 4,000 xg Centrifuge B: rotor radius - 7 cm; m...
A: Centrifuge is a device used for separating molecules having different densities. The process is call...
Q: 10. The degree of unsaturation of lipid can be measured as A. saponification number B. iodine number...
A: Saturated fats are the fatty acids in which the hydrocarbon chain with a carboxyl group contains car...
Q: Which of the following is the correct order of events in mitosis? 1. Sister chromatids line up a...
A: In mitotic cell division the phase is the period in which the duplicated chromosomes are divided eq...
Q: -Inhibitor +Inhibitor [S] (mM) Vο&νβσπ: (μmol/sec). Vο&νβσπ:&νβσπ: (μmollsec) 0.0001 33 17 0.0005 71...
A: From the given data, I have calculated 1/S and 1/V0 in absence and presence of inhibitor. The plot b...
Q: Tabulate the main structural features of DNA and RNA. In one sentence, point out the salient differe...
A: Nucleic acids are made up of nucleotides. Nucleotides are the monomer units of nucleic acid. Nucleot...
Q: Which of the following chromatographic techniques has an attached ligand on the stationary phase? A...
A: Chromatography is a laboratory technique that is used to separate components, or solutes, of a mixtu...
Q: Proteins are compounds composed of many _________ linked together
A: The protein which is most important constituent for every living organisms. The term protein firstly...
Q: Discuss about enzymes: function, definition, and examples.
A: The human body is made up of various types of cells, tissues, and other complicated organs. To maint...
Q: Explain the importance of knowing the conformation/structure of proteins.
A: Proteins are biomolecules composed of amino acids. The amino acids are joined together through pepti...
Q: Analysis of a octapeptide revealed the presence of the following products: 2 Arg, 1 Gly, 1 Met, 1 Tr...
A: Edman Degradation – This is method of peptide sequencing. In this method amino terminal residue is l...
Q: What characteristic makes each amino acid unique from one another?
A: Amino acids are organic compounds with functional group namely carboxyl and amino. There are 20 amin...
Q: 12. Polenske value of fatty acid indicates A. how much unsaturation is there in the fatty acid B. Le...
A: Volatile fatty acid : Linear small(short chain) aliphatic mono-carboxylate compound, like the acetic...
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They...
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. Allosteric enzymes are th...
Q: 1) Based on the composition of fatty acids present in each TAG , predict which TAG (X, Y or Z)has th...
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since ...
Q: When answering the questions below, please use the ONE-LETTER CODE for the amino acid, with NO space...
A: Trypsin and chymotrypsin are the proteases that break down protein into individual amino acid...
Q: Two peptide sequences are shown below. Peptide A: N-term – GDL – C-term Peptide B: N-term – GTL – C-...
A: A peptide is a short chain of amino acids that contains one or more amino acids. Peptide bonds conne...
Q: D-Erythrulose in cyclic form:
A: Erythrulose is chemically teterose carbohydrates.formula for erythrulose is C4H8O4. It is used in co...
Q: Discuss about enzymes: function, definition, and examples.
A: At high temperatures, most of the enzymes denature and unfold similarly low temperatures als...
Q: Levels of RNA structure/folding include a Secondary and Tertiary b Primary and Secondary ...
A: Ribonucleic acid (RNA) is a single-stranded nucleic acid that takes part in protein synthesis. The b...
Q: 1.What type of bonds stabilizes the quaternary structure of proteins? * A. Peptide bond B. Electrost...
A: The structure of a protein is classified into four different levels of organizations: the primary, s...
Q: Briefly describe four ways in which a protein could be denatured.
A: The highly organized structures of proteins are true works of chemical architecture. Denaturation re...
Q: Explain the principle involved in blood typing.
A: The most significant blood typing is based on ABO groups, though 20 different blood groups are known...
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They...
A: Enzymes are protein molecules that increase the rate of reactions by decreasing the activation energ...
Q: The restriction digests of the cloned Drosophila gene can provide direct visible evidence of a mutat...
A: We can use the technique of Southern blotting to detect and isolate the DNA fragment with the Gene O...
Q: The type of linkages found between monomer units in nucleic acids is a ether b amide c p...
A: Introduction: Nucleic acids are molecules that store genetic formation for cellular growth and repro...
Q: Lecithins and cephalins are both
A: Lecithin are mixture of glycerophospholipids like phosphatidylcholine, phosphatidylethanolamine, pho...
Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed f...
A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of th...
Q: Under what conditions will lactic acid accumulate in skeletal muscle? Select one: A. When NADH is d...
A: A reduction in muscle force generated over time or as a result of pathological conditions is referre...
Q: What are the changes occur in oxidative randicity? Explain.
A: Oxidative rancidity is a chemical process when lipids oxidize through a complex series of reactions ...
Q: Can a chemical reaction takes place without the application of enzyme or catalyst? Why or why not?
A: Introduction: A chemical reaction is a change in which one or more substances undergo conversion to...
Q: What type of mutation can we get if we use phones and laptops too much
A: Phones and laptops are widely used gadgets nowadays . These devices emit the harmful electro magneti...
Step by step
Solved in 3 steps
- Briefly explain WHY a 5 7-methylguanosine cap is only added to mRNA, not to tRNA orrRNA. (Please note that I am not looking for the function of the 5’ cap, but for the mechanismrestricting capping to messenger RNA.)TRUE FALSE EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in prokaryotic translation. The sigma o subunit of RNA polymerase is replaced by NusA to recognise the promoter region of a gene. The -10 and -35 sequences in E. coli DNA are referred to as untranslated region. In human, translation begins before transcription of an mRNA completes. The distal histidine stabilises the iron in heme group of a deoxyhaemoglobin. Receptor for epinephrine consists of seven transmembrane helices. Membrane receptors bind to hydrophobic signaling molecules. Amino acids, glucose and fatty acids are taken up by transporters into liver cells. Glycerol and fatty acids are synthesized from the intermediates of glycolysis. Synthesis of fatty acid occurs in cytoplasm. Triacylglycerol can be obtained from diet and also synthesized in liver cells. Ammonia and keto acid are formed in transamination.Usually found in prokaryotes, regulatory sequences lying adjacent to the DNA being transcribed are composed of a promoter located next to a(n) ____ that interacts and is controlled by regulatory protein. TATA box rho binding domain RNA polymerase holoenzyme operator
- EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in prokaryotic translation. The sigma subunit of RNA polymerase is replaced by NusA to recognise the promoter region of a gene. The -10 and -35 sequences in E. coli DNA are referred to as untranslated region. In human, translation begins before transcription of an mRNA completes. this statement true or false.6) The C-terminal domain (CTD) of yeast RNA polymerase II (RPB) subunit RPB1 contains the repeating amino acid sequence "-PTSPSYS-". Explain how this sequence plays a role in the regulation of the transcriptional activity of the yeast RPB holoenzyme.During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, II
- identify start/end site, which amino acid will be on the tRNA that is the first to bind to the A site of ribosome, anticodon on the tRNA in the P site of the ribosome when release factor bings to A site, and what amino acid sequence of the protein that will be formed from mRNA? Here is the mRNA sequence:5'GUUUCCCGUAUACAUGCGUGCCGGGGGCCCGUUACCAGGCCUCAUUAUUGGAUAACGGAAAAAAAAAAAAA3'Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′19Eukaryotic messenger RNA and hnRNA both have poly (A) tails at their 3'-ends. Yesorno 20Messenger RNA splicing and export are uncoupled processes. Yesorno twenty oneWhich of the following plays an important role in directing newly synthesized proteins to specific cellular destinations?A.signal sequenceb.nuclear localization signalc.chain elongation stretchD.Shine – Dalgarno
- IF-2, IF-3, EF-Tu, EF-G and RF-1 are all involved in prokaryotic translation. List the roles of each factor in the process of translation--please be sure to note if the factor binds GTP. (You can list the factors with the function listed next to the factor.)Given the following genomic sequence which contains 2 exons and CDNA sequence predidt the amino acid sequence of the exons which are part of the coding region of a protein. How many nucleotides make up the intron? Second letter UAU TV UACJ UAA Stop|UGA Stop A UAG Stop UG Trp UUU1 Phe UUCJ UGU1, UGCJ UCU) Cys UCC Ser UCA ULA UCG CUUT CUC CUA CUG CCU CAUT C4C His CAAT CAGJ OGU CCC Leu CA CGC FArg CGA Gln CGG Pro CCG AUU AUC lle AUA ACU AGU AAU AACJ AAA 1 AAGYS Asn Ser ACC Thr ACA AGC. AGA Arg AUG Mer ACG, AGG GCU GAUT GACJ GGU GGC GUU Asp GUC Val GUA Gly Ala GAA Glu GAGJ GGA GGG GUG GCG G. Genomic antisense sequence: 5'-TAACTGATTCTAGGCTACTCTTTCACCTAA-3" CDNA sequence: 5'-TAACTGATTTCTTTCACCTAA-3" I Use the editor to format your answer First letter 皇 Third letterc) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…
