Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 29, Problem 3P
Substrate Binding by RNA Polymerase RNA polymerase has t binding sites for ribonucleoside triphosphates: the initiation site and the elongation site. The initiation site has a greater
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Briefly explain WHY a 5 7-methylguanosine cap is only added to mRNA, not to tRNA orrRNA. (Please note that I am not looking for the function of the 5’ cap, but for the mechanismrestricting capping to messenger RNA.)
Describe the prokaryotic translation initiation shown in the diagram. Define the convention of protein synthesis (directionality of synthesis) as well as the meaning of the A, P, and E sites of the ribosome.
please provide handwritten explanation
1 it is written tranlation and trancription occurs early in bacteria does that means in bacteria central dogma rule dosen't follow
I am sending you two images
Chapter 29 Solutions
Biochemistry
Ch. 29 - Prob. 1PCh. 29 - The Events in Transcription Initiation Describe...Ch. 29 - Substrate Binding by RNA Polymerase RNA polymerase...Ch. 29 - Comparison of Prokaryotic and Eukaryotic...Ch. 29 - Prob. 5PCh. 29 - Prob. 6PCh. 29 - Prob. 7PCh. 29 - Alternative Splicing Possibilities Suppose exon 17...Ch. 29 - Prob. 9PCh. 29 - Prob. 10P
Ch. 29 - Post-transcriptional Modification of Eukaryotic...Ch. 29 - Prob. 12PCh. 29 - Prob. 13PCh. 29 - The Lariat Intermediate in RNA Splicing Draw the...Ch. 29 - Prob. 15PCh. 29 - Prob. 16PCh. 29 - Prob. 17PCh. 29 - Prob. 18PCh. 29 - Figure 29.15 highlights in red the DNA phosphate...Ch. 29 - Chromatin decompaction is a preliminary step in...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- RNA transcription reach low error rate under non-equilibrium steady state, what is the energy source to drive transcription ?arrow_forwardThe CTD of the largest subunit of RNA polymerase II can be phosphorylated at multiple serine residues. What are the conditions that lead to the phosphorylated versus nonphosphorylated RNA polymerase II CTD?arrow_forwardEukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′ triphosphate linkage, and by methylation at the 2'-hydroxyl of the penultimate nucleoside. What cofactors involved in the capping reaction? Show their structure and propertiesarrow_forward
- Below is an image of the predicted RNA secondary structure for an RNA aptamer that binds FGF5. The boxed nucleotide bases are conserved across all of the high-affinity FGF5 binding RNA aptamers. Although the precise structural mechanism of FGF5 binding is not known, provide a hypothesis for how these bases might contribute to the binding specificity. Explain your answer Loop I a G Stem I 5' с с U 3' g-c g-c u-a a-u 9-c c-g u-a g-c u-a a-u Loop II U CAUGCCUC 111111 UAUGU IITT ACCUACAGAGCGAC AUAC UA Stem II Stem IIIarrow_forward6) The C-terminal domain (CTD) of yeast RNA polymerase II (RPB) subunit RPB1 contains the repeating amino acid sequence "-PTSPSYS-". Explain how this sequence plays a role in the regulation of the transcriptional activity of the yeast RPB holoenzyme.arrow_forwardTRUE FALSE EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in prokaryotic translation. The sigma o subunit of RNA polymerase is replaced by NusA to recognise the promoter region of a gene. The -10 and -35 sequences in E. coli DNA are referred to as untranslated region. In human, translation begins before transcription of an mRNA completes. The distal histidine stabilises the iron in heme group of a deoxyhaemoglobin. Receptor for epinephrine consists of seven transmembrane helices. Membrane receptors bind to hydrophobic signaling molecules. Amino acids, glucose and fatty acids are taken up by transporters into liver cells. Glycerol and fatty acids are synthesized from the intermediates of glycolysis. Synthesis of fatty acid occurs in cytoplasm. Triacylglycerol can be obtained from diet and also synthesized in liver cells. Ammonia and keto acid are formed in transamination.arrow_forward
- Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′arrow_forwardTFIID TFIIA TFIIH TBP TFIIB TFIIF TFIIEarrow_forwardDifferent sensitivities to the mushroom toxin a-amanitin distinguish the three RNA polymerases from one another. Which of the following properties listed below also distinguish RNA Polymerase II from Pol I and Pol III? Options: Only RNA Pol II possesses a large subunit RNA Polymerase I and RNA Polymerase III do not require TBP for optimal transcription efficiency only RNA Polymerase II requires an ATP-dependent helicase to melt the DNA around the transcription start site Only RNA Polymerase II resembles the prokaryotic RNA Polymerase RNA Pol II has an extended N terminal region that becomes phosphorylated during intiationarrow_forward
- 1. (a) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to sup- press synthesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix - reverse turn - helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein. A diagram of the trp repressor dimer is also shown. Trp Prl Trp Prl 80 -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly-Ile- -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr-Val- trp helix 5 70 trp helix 4 Prl helix 80 Prl helix Ala-Thr-Ile-Thr-Arg-Gly-Ser-Asn-Ser-Leu-Lys-Ala-Ala- Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- reverse turn 90 Comparing the two protein sequences above, identify all amino acid pairs that differ in electrostatic charge due to proton dissociable groups (assume pH 7). Indicate the charge of both residues for each such pair. (b) Circle the pair of residues for which the electrostatic charge due to…arrow_forwardPredict the level of genetic activity of the lac operon as well as the status of the lac repressor and the CAP protein under the cellular conditions listed in the accompanying table. Lactose Glucose (a) - - (b) + - (c) - + (d) + +arrow_forwardin m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region of an unknown Escherichia coli genome. (Note: Transcription starts at Transcription Start Site (TSS).) TSS -3' -5' +1 (i) Name the specific regions that can be recognized by sigma factor and indicate the locations in the diagram above. (ii) How does Sigma factor trigger the initiation of transcription?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY