Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 29, Problem 5P
Interpretation Introduction
Interpretation:
The difference in the two modes of protein DNA recognition should be determined.
Concept introduction:
DNA or Deoxyribonucleic acid is a molecule made of two chains which coil around one another. These form a double helix which carries instructions genetical in nature like related to reproduction, growth, development, functioning of the living organisms.
Specific DNA regions are recognized by the DNA binding proteins by shape readout or by reading the base.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
B PLEASE second one
Neeed help:. . Fill out the following table, using wobble whenever possible
9a please
Chapter 29 Solutions
Biochemistry
Ch. 29 - Prob. 1PCh. 29 - The Events in Transcription Initiation Describe...Ch. 29 - Substrate Binding by RNA Polymerase RNA polymerase...Ch. 29 - Comparison of Prokaryotic and Eukaryotic...Ch. 29 - Prob. 5PCh. 29 - Prob. 6PCh. 29 - Prob. 7PCh. 29 - Alternative Splicing Possibilities Suppose exon 17...Ch. 29 - Prob. 9PCh. 29 - Prob. 10P
Ch. 29 - Post-transcriptional Modification of Eukaryotic...Ch. 29 - Prob. 12PCh. 29 - Prob. 13PCh. 29 - The Lariat Intermediate in RNA Splicing Draw the...Ch. 29 - Prob. 15PCh. 29 - Prob. 16PCh. 29 - Prob. 17PCh. 29 - Prob. 18PCh. 29 - Figure 29.15 highlights in red the DNA phosphate...Ch. 29 - Chromatin decompaction is a preliminary step in...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the parent DNA (3' to 5') strand correspond to a start codon and its last three nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it down as follows: a. the sequence of parent DNA (template) 3' A C A TT 5' 3' Upon undergoing DNA replication, show what one daughter DNA molecule will look like. Write it down as follows: b. the sequence of DNA Daughter 1: 3' 5' 5' 3' C. the sequence of DNA Daughter 2: 3' 3' 5' in inarrow_forwardExplain translation more depth please im really confusedarrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward
- DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.arrow_forwarda. Do any strands of nucleic acid exist in nature inwhich part of the strand is DNA and part is RNA?If so, describe when such strands of nucleic acidare synthesized. Is the RNA component at the 5′end or at the 3′ end?b. RNA primers in Okazaki fragments are usually veryshort, less than 10 nucleotides and sometimes asshort at 2 nucleotides in length. What does this facttell you about the processivity of the primaseenzyme—that is, the relative ability of the enzymeto continue polymerization as opposed to dissociatingfrom the template and from the molecule beingsynthesized? Which enzyme is likely to have a greaterprocessivity, primase or DNA polymerase III?arrow_forwardIf mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?arrow_forward
- You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosomearrow_forwardRecall from the central dogma that DNA codes for mRNA, which then codes for protein. Also recall that directionality matters! DNA 3' TAC - CTA -AAT - TGC - TCG-ATT 5' mRNA 5' ???- ???- ???- ???- ???- ??? 3' protein ? ? ? ? ? (A) Indicate whether the DNA sequence provided is the sense strand or the antisense strand. ? that (B) For the DNA sequence given above, write out the mRNA sequence that results. (C) Now write the amino acid sequence that results from the mRNA sequence you wrote in part (B). Use the three-letter abbreviations for the amino acids. (D) What happens if the A that is bolded and underlined in the given DNA sequence is mutated (changed) to a C? How is the protein affected? This can be answered in a few words, but be specific! (E) Now let's pretend for a moment that the protein being affected is ATP-ADP translocase. What, if anything, would happen to the citric acid cycle? This should be answered in a few words/one sentence max.arrow_forwarde.) ( acid buffer an appropriate choice? Why or why not? If I need to perform an enzymatic reaction at pH 6.5, is a citric )Describe the process of transcription in as much detail as possible using pictures and words beginning with a paired (duplexed) strand of DNA and ending with a processed mRNA which is ready for translation. 7.arrow_forward
- Give me a clear Explanation Detailed Solution..no need handwrittenarrow_forwardWithin living cells, many different proteins play importantfunctional roles by binding to DNA. Some proteins bind to DNA butnot in a sequence-specific manner. For example, histones are proteinsimportant in the formation of chromosome structure. The positivelycharged histone proteins bind to the negatively charged phosphategroups in DNA. In addition, several other proteins interact with DNAbut do not require a specific nucleotide sequence to carry out theirfunction. For example, DNA polymerase, which catalyzes thesynthesis of new DNA strands, does not bind to DNA in a sequencedependentmanner. By comparison, many other proteins do interactwith nucleic acids in a sequence-dependent fashion. This means that a specific sequence of bases can provide a structure that isrecognized by a particular protein.Someexamples include transcription factors that affect the rate oftranscription and proteins that bind to origins of replication inbacteria.What topic in genetics does this question address?arrow_forwardWithin living cells, many different proteins play importantfunctional roles by binding to DNA. Some proteins bind to DNA butnot in a sequence-specific manner. For example, histones are proteinsimportant in the formation of chromosome structure. The positivelycharged histone proteins bind to the negatively charged phosphategroups in DNA. In addition, several other proteins interact with DNAbut do not require a specific nucleotide sequence to carry out theirfunction. For example, DNA polymerase, which catalyzes thesynthesis of new DNA strands, does not bind to DNA in a sequencedependentmanner. By comparison, many other proteins do interactwith nucleic acids in a sequence-dependent fashion. This means thata specific sequence of bases can provide a structure that isrecognized by a particular protein.Someexamples include transcription factors that affect the rate oftranscription and proteins that bind to origins of replication inbacteria. With regard to the three-dimensional structure of…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license