Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 29, Problem 5P
Interpretation Introduction
Interpretation:
The difference in the two modes of protein DNA recognition should be determined.
Concept introduction:
DNA or Deoxyribonucleic acid is a molecule made of two chains which coil around one another. These form a double helix which carries instructions genetical in nature like related to reproduction, growth, development, functioning of the living organisms.
Specific DNA regions are recognized by the DNA binding proteins by shape readout or by reading the base.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
B PLEASE second one
A. DNA Replication
Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the
parent DNA (3' to 5') strand correspond to a start codon and its last three
nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it
down as follows:
a. the sequence of parent DNA (template)
3'
A C
A TT 5'
3'
Upon undergoing DNA replication, show what one daughter DNA molecule will look
like. Write it down as follows:
b. the sequence of DNA Daughter 1:
3'
5'
5'
3'
C. the sequence of DNA Daughter 2:
3'
3'
5'
in
in
What type of DNA structure is recognized by RecG and RuvABC?Do you think these proteins recognize DNA sequences? Be specificabout what type(s) of molecular recognition these proteins canperform.
Chapter 29 Solutions
Biochemistry
Ch. 29 - Prob. 1PCh. 29 - The Events in Transcription Initiation Describe...Ch. 29 - Substrate Binding by RNA Polymerase RNA polymerase...Ch. 29 - Comparison of Prokaryotic and Eukaryotic...Ch. 29 - Prob. 5PCh. 29 - Prob. 6PCh. 29 - Prob. 7PCh. 29 - Alternative Splicing Possibilities Suppose exon 17...Ch. 29 - Prob. 9PCh. 29 - Prob. 10P
Ch. 29 - Post-transcriptional Modification of Eukaryotic...Ch. 29 - Prob. 12PCh. 29 - Prob. 13PCh. 29 - The Lariat Intermediate in RNA Splicing Draw the...Ch. 29 - Prob. 15PCh. 29 - Prob. 16PCh. 29 - Prob. 17PCh. 29 - Prob. 18PCh. 29 - Figure 29.15 highlights in red the DNA phosphate...Ch. 29 - Chromatin decompaction is a preliminary step in...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Explain translation more depth please im really confusedarrow_forwardDNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.arrow_forwardNonearrow_forward
- Describe the d=features of the following DNA-binding domains and how they interact with DNA. Helix-turn-Helix Zinc Finger Leucine Zipper Helix-loop-Helixarrow_forwarda. Do any strands of nucleic acid exist in nature inwhich part of the strand is DNA and part is RNA?If so, describe when such strands of nucleic acidare synthesized. Is the RNA component at the 5′end or at the 3′ end?b. RNA primers in Okazaki fragments are usually veryshort, less than 10 nucleotides and sometimes asshort at 2 nucleotides in length. What does this facttell you about the processivity of the primaseenzyme—that is, the relative ability of the enzymeto continue polymerization as opposed to dissociatingfrom the template and from the molecule beingsynthesized? Which enzyme is likely to have a greaterprocessivity, primase or DNA polymerase III?arrow_forwardOnce translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?arrow_forward
- Describe how histones including H2A, H2B, H3 and H4 play a critical role in DNA packaging.arrow_forwardMany thanksarrow_forward. The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?arrow_forward
- You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosomearrow_forwardExplain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA molecule without breaking the hydrogen bonds that hold the bases together. indicate how, through such contacts, a protein can distinguish a T-A from a C-G pair. indicate the parts of the nucleotide base pairs that could form noncovalent interactions— hydrogen bonds, electrostatic attractions, or hydrophobic interactions -with a DNA-binding protein.arrow_forward. The table opposite shows the standard (coding strand) DNA winlet codes for the 20 amino acids involved in protein synthesi A section of DNA template strand is shown below. 5'-CATCCAAATTGTTGCCCG-3' (a) Write down the sequence of amino acids formed when ti section of DNA is transcribed and translated.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license