FUND.OF GEN CHEM CHAP 1-13 W/ACCESS
16th Edition
ISBN: 9781323406038
Author: McMurry
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 26, Problem 26.52AP
Interpretation Introduction
Interpretation:
An intron and exon term has to be defined.
Concept Introduction:
RNA synthesis: The process of RNA synthesis is Transcription. A small section of DNA unwinds, only one of the two strands act as template and the other strand as informational strand. The complementary bases are attached one by one by the action of RNA polymerase at template strand on moving down. The newly generated RNA is the exact copy of the informational strand, with the exception that a U replaces each T in the template DNA. The RNA synthesised carries genetic information and directs protein synthesis.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Here is part of a gene:
GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC
If the bottom strand of the DNA carries the gene, write the mRNA that would be transcribed from the bottom strand of the DNA:
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA:
3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'
Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________
Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47:
mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-
polypeptide chain: ________--________--________--________--________--________--________--________
How important and useful to the cell
is the ability of the DNA to assume
various forms? Why are these
various forms necessary?
Chapter 26 Solutions
FUND.OF GEN CHEM CHAP 1-13 W/ACCESS
Ch. 26.2 - Name the nucleoside shown here. Copy the...Ch. 26.2 - Prob. 26.2PCh. 26.2 - Draw the structure of 2-deoxyadenosine...Ch. 26.2 - Prob. 26.4PCh. 26.2 - Prob. 26.5PCh. 26.3 - Prob. 26.6PCh. 26.3 - Prob. 26.7PCh. 26.4 - Prob. 26.8PCh. 26.4 - Draw the structures of adenine and uracil (which...Ch. 26.4 - Prob. 26.10P
Ch. 26.4 - Prob. 26.11KCPCh. 26.6 - What are Okazaki fragments? What role do they...Ch. 26.6 - Prob. 26.13PCh. 26.8 - Prob. 26.14PCh. 26.8 - Prob. 26.15PCh. 26.9 - Prob. 26.1CIAPCh. 26.9 - Prob. 26.2CIAPCh. 26.9 - Using a variety of sources, research which...Ch. 26.9 - Prob. 26.4CIAPCh. 26.9 - List possible codon sequences for the following...Ch. 26.9 - Prob. 26.17PCh. 26.9 - What amino acids do the following sequences code...Ch. 26.9 - Prob. 26.19PCh. 26.10 - Prob. 26.20PCh. 26.10 - What anticodon sequences of tRNAs match the mRNA...Ch. 26 - Combine the following structures to create a...Ch. 26 - Prob. 26.23UKCCh. 26 - Copy the following simplified drawing of a DNA...Ch. 26 - Prob. 26.25UKCCh. 26 - Prob. 26.26UKCCh. 26 - Prob. 26.27APCh. 26 - Prob. 26.28APCh. 26 - Prob. 26.29APCh. 26 - Prob. 26.30APCh. 26 - Prob. 26.31APCh. 26 - For the following molecule: (a) Label the three...Ch. 26 - Prob. 26.33APCh. 26 - Prob. 26.34APCh. 26 - Prob. 26.35APCh. 26 - Prob. 26.36APCh. 26 - Draw structures to show how the sugar and...Ch. 26 - What is the difference between the 3 end and the 5...Ch. 26 - Prob. 26.39APCh. 26 - Prob. 26.40APCh. 26 - Draw the complete structure of the RNA...Ch. 26 - Prob. 26.42APCh. 26 - Prob. 26.43APCh. 26 - Prob. 26.44APCh. 26 - Prob. 26.45APCh. 26 - If a double-stranded DNA molecule is 22% G, what...Ch. 26 - How are replication, transcription, and...Ch. 26 - Why is more than one replication fork needed when...Ch. 26 - Prob. 26.49APCh. 26 - What are the three main kinds of RNA, and what are...Ch. 26 - Prob. 26.51APCh. 26 - Prob. 26.52APCh. 26 - Prob. 26.53APCh. 26 - Prob. 26.54APCh. 26 - What is a codon and on what kind of nucleic acid...Ch. 26 - Prob. 26.56APCh. 26 - Prob. 26.57APCh. 26 - Prob. 26.58APCh. 26 - What amino acids are specified by the following...Ch. 26 - Prob. 26.60APCh. 26 - What anticodon sequences are complementary to the...Ch. 26 - Prob. 26.62APCh. 26 - Refer to Problem 26.62. What sequence appears on...Ch. 26 - Refer to Problems 26.62 and 26.63. What dipeptide...Ch. 26 - Prob. 26.65APCh. 26 - Prob. 26.66APCh. 26 - Prob. 26.67APCh. 26 - Prob. 26.68APCh. 26 - Prob. 26.69APCh. 26 - Prob. 26.70CPCh. 26 - Prob. 26.71CPCh. 26 - Prob. 26.73CPCh. 26 - Prob. 26.75GPCh. 26 - Prob. 26.76GPCh. 26 - Prob. 26.77GPCh. 26 - Prob. 26.78GP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Select all TRUE statements related to the process of transcription. More than one answer is possible. The enzyme helicase separates the complimentary base pairs that hold double-stranded DNA together. MRNA is formed by joining ribonucleotides that pair with the template strand of DNA MRNA is formed by joining ribonucleotides that pair with the coding strand of DNA exons are removed from MRNA. Okazaki fragments form on the lagging strand. introns are removed from mRNA. The enzyme DNA gyrase encompasses both strands of DNA and uncoils the helix of double-stranded DNA. transcription is the process by which MRNA codons are translated to proteins. MRNA formed will be complimentary to the coding strand. DNA is unwound to expose the targeted genearrow_forwardExplain briefly the meaning of this statement: Genetic information is encoded in the DNA molecule.arrow_forwardA strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.arrow_forward
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forwardWhat is meant by the statement “The genetic code is universal”? What is the significance of this finding?arrow_forwardIn eukaryotic cells, the length of the transcribed RNA is almost equal to the corresponding DNA strand. True or false?arrow_forward
- Translate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…arrow_forwardConsider Molecule X, which is found in all living cells. This molecule is transcribed from a stretch of DNA in the nucleus. Each nucleobase on the DNA produces a matching nucleobase on this molecule. Every 3-base codon specifies an amino acid in a protein. What is the name of X? Your answer should be one word, or a short two- or three-word phrase. Spelling counts. Note: if there is more than one possible answer, separate each answer with a comma. x 5arrow_forwardDefine the term DNA.arrow_forward
- Eukaryotic DNA is typically organized into two major regions called euchromatin and heterochromatin. Which of the following applies to euchromatin? They are regions of little or no transcription activity. They are regions of highly condensed chromatin. They are regions that are uncoiled and active in transcription. They may refer to regions near the ends of chromosome (telomeres). They refer to regions that contain the centromere.arrow_forwardDefine Genome, Transcriptome, and Proteome. Include examples of each one and a very detailed description on their importance and functionality.arrow_forwardSeveral different nucleic acids are involved in the process of getting a protein produced from a gene. DNA contains the "genetic code" for the protein. DNA is double-stranded, but only one strand is transcribed into MRNA. The MRNA then goes into the cytoplasm where it is translated into protein with the help of TRNA. At each stage of the process, there is base complementarity (A pairs with T/U and C pairs with G) between the nucleic acids involved to ensure the integrity of the DNA blueprint for the protein being produced. Therefore, some of the four strands of nucleic acids involved will match (except U replaces T in RNA) and some will have base complementarity. Indicate whether there is matching (1) or base complementarity (2) between the following nucleic acids. DNA sense strand and MRNA DNA sense strand and tRNA DNA antisense strand and MRNA MRNA and TRNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license