The amino acids sequence for the given mRNA base sequence code has to be predicted. Concept Introduction: Codon: A sequence of three ribonucleotides in the mRNA chain that codes for a specific amino acid; also a three- nucleotide sequence that is a stop codon and stops translation. Genetic code: The sequence of nucleotides, coded in triplets (codons) in mRNA that determines the sequence of amino acids in protein synthesis. Translation: A tRNA molecule is a single polynucleotide chain held together by regions of base pairing in a partially helical structure. An amino acid is bonded to its specific tRNA by an ester linkage. Connecting specific amino acid at end of the tRNA is known as charging tRNA. Once done, tRNA is ready to be used in the protein synthesis. At the other end of the tRNA, three anticodons are present which are complementary to the codons present in mRNA. Once the anticodons pairs off with codons, the amino acid at terminal end of the tRNA is delivered and attached to the growing protein chain. Illustrated relationships are: DNA informational strand : 5’ ATG CCA GTA GGC CAC TTG TCA 3’ DNA Template strand : 3’ TAC GGT CAT CCG GTG AAC AGT 5’ m RNA: 5’ AUG CCA GUA GGC CAC UUG UCA 3’ protein: Met Pro Val Gly His Leu Ser Notice: 5’ end of the mRNA strand codes for the N-terminal amino acid, whereas the 3’ end of the mRNA strand codes for the C-terminal amino acid. Proteins are always written N-terminal to C-terminal, reading left to right.

Question

Want to see the full answer?

Answer 1

Question

Chapter 26.10, Problem 26.20P

Interpretation Introduction

Interpretation:

The amino acids sequence for the given mRNA base sequence code has to be predicted.

Concept Introduction:

Codon: A sequence of three ribonucleotides in the mRNA chain that codes for a specific amino acid; also a three-nucleotide sequence that is a stop codon and stops translation.

Genetic code: The sequence of nucleotides, coded in triplets (codons) in mRNA that determines the sequence of amino acids in protein synthesis.

Translation: A tRNA molecule is a single polynucleotide chain held together by regions of base pairing in a partially helical structure. An amino acid is bonded to its specific tRNA by an ester linkage. Connecting specific amino acid at end of the tRNA is known as charging tRNA. Once done, tRNA is ready to be used in the protein synthesis.

At the other end of the tRNA, three anticodons are present which are complementary to the codons present in mRNA. Once the anticodons pairs off with codons, the amino acid at terminal end of the tRNA is delivered and attached to the growing protein chain.

Illustrated relationships are:

**DNA informational strand : 5’ ATG CCA   GTA GGC CAC   TTG   TCA 3’

DNA Template strand: 3’ TAC GGT   CAT CCG GTG   AAC   AGT 5’

mRNA: 5’ AUG CCA GUA GGC CAC UUG   UCA 3’

protein:** Met    Pro     Val    Gly     His    Leu      Ser

Notice: 5’ end of the mRNA strand codes for the N-terminal amino acid, whereas the 3’ end of the mRNA strand codes for the C-terminal amino acid. Proteins are always written N-terminal to C-terminal, reading left to right.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?

Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G

What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter abbreviation with hyphens and no spaces in between.