Genetic Analysis: An Integrated Approach (3rd Edition)
Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 8, Problem 5P

The following is a portion of an mRNA sequence:

3'-AUCGUCAUGCAGA-5'

a. During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide added to the portion of mRNA shown? Explain how you know.

b. Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands.

c. Identify the direction in which the promoter region for this gene will be located.

Blurred answer
Students have asked these similar questions
a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and 3' ends. b. translate this RNA sequence in 1a into a protein sequence c. Give the sequence of mRNA that would be transcribed off of the top strand and label its 5' and 3' ends. d. Translate this RNA sequence in 1c into a protein sequence
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deleted

Chapter 8 Solutions

Genetic Analysis: An Integrated Approach (3rd Edition)

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY