Concept explainers
The DNA sequence below gives the first
Write the polarity of the two DNA strands shown.
Give the mRNA transcript sequence and the polarity of the transcript.
Assuming the sequence shown is part of a bacterial gene. Draw the approximate positions of the promoter sequence and the termination sequence.
Assuming the sequence shown is part of a bacterial gene, what consensus sequence (s) would you expect to identify in the promoter?
Write the anticipated bacterial consensus sequence(s) in the approximate position(s) on the diagram.
Assuming the sequence shown is part of a eukaryotic gene, what consensus sequence(s) would you expect to identify within about
Write the anticipated eukaryotic consensus sequence(s) in the approximate position(s) on the diagram.
Want to see the full answer?
Check out a sample textbook solutionChapter 8 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
- Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the requested format of your answers. Do not consider any RNA or protein processing events in your answers. transcription terminates promoter (transcription initiates here) 3'-TACATGGAGGGTCGTACTAATTATGGATCTAGTTATCATGTA - 5' 5' - ATGTACCTCCCAGCATGATTAATACCTAGATCAATAGTACAT-3' 2 1. The type your answer... I strand will be used as the template for transcription. (enter only top or bottom; any deviation from this answers will receive no credit. The sequence of the RNA encoded by the gene is type your answer... Type in only the nucleotide sequence of the RNA in the 5' to 3' direction (do not label the ends or add any punctuation marks or spaces). The sequence of the protein encoded by the gene is type your answer... Type the protein sequence using the single-letter amino acid abbreviations from its N to C terminus. Do not label the ends or add any spaces or punctuation marks! #♡ 3 4 % 5 here ↓ < 6…arrow_forwardRefer to a genetic code table for the question. below is a portion of the template strand of a particular gene sequence. Which of the following would be the correct sequence of amino acids in the protein that this portion of the gene encodes? (Note that there are no entrance in this gene sequence, and this portion is found in the middle of the coding sequence, past the start codon, so you should transcribe and translate the entire portion of this sequence) template DNA : 3' - ACG GGT TCC TTT AAC GCG TAG -5' A) Thr-Gly-Ser-Phe-Asn-Ala B) Cys-Pro-Arg-Lys-Leu-Arg-Ile C) there is not enough information given to determine the amino acid sequence of this portion of the gene .arrow_forwardPlease answerarrow_forward
- Give typing answer with explanation and conclusionarrow_forwardComplete the following table with the proper terms: Process Molecule made name of monomer Name of template that provides information Direction in which template is read Name of enzyme responsible for synthesis Replication Transcription translationarrow_forwardThe sequence below is DNA from an unknown cell. Use what you know about transcription to infer some things about the cell it came from and the RNA product it will form. Be sure to explain your answer for each question. 5’ – AGATTCAGGTCGAACATTATAGTCCAACTATACGGCGTTATGTCAATCCGCA – 3’ 3’ – TCTAAGTCCAGCTTGTAATATCAGGTTGATATGCCGCAATACAGTTAGGCGT – 5’ Which direction is upstream (left or right)? Possible Answers: A. Right - the promoter lies downstream of the transcription start site B. Left - the promoter lies upstream of the transcription start site C. Right - the promoter lies upstream of the transcription start site D. Left - the promoter lies downstream of the transcription start sitearrow_forward
- Below is an electron micrograph illustrating the process of simultaneous transcription and translation in a prokaryotic cell. Use this illustration to answer the question. A. Which of the following statements is correct? 1. The direction indicated by A, is the correct direction of RNA polymerase movement. 2. If C and D are both pointing to the first ribosome in the chain, then ribosome C is carrying a longer polypeptide chain. 3. If E is pointing to mRNA, then it is pointing to the 5'end of the mRNA. 4. If B is pointing to the DNA, then it is pointing to the 5' end of the DNA. O A. 1, 2 and 3 O B. 1 and 3 O C. 2 and4 O D. 4 only O E. All of 1, 2, 3 and 4 are correctarrow_forwardGive typing answer with explanation and conclusion Which of the triplets below is a possible anticodon for a tRNA that transports proline to a ribosome? Use your genetic code. Group of answer choices 3′-UUC-5′ 3′-CCG-5′ 3′-GGC-5′ 3′-CCC-5′arrow_forwardUse the following information to answer the next question. The DNA strand shown below is thought to contain the genetic code for part of an enzyme B-galactosidase which is involved in lactose metabolism. (Read the DNA beginning at the left.) -A-T-A-T-G-G-G-G-C-A-T-G The second amino acid coded from the section of DNA for B-galactosidase is Select one: a. thymine b. tryptophan c. serine d. threoninearrow_forward
- Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:arrow_forwardGive typing answer with explanation and conclusion In some cases, as an enzyme does its job it leaves a situation which must later be resolved by another enzyme. Of the options below, which enzyme resolves/fixes the situation/problem left by the primase enzyme? Single-stranded DNA binding protein Helicase Topoiosomerase RNase H Telomerasearrow_forwardGive typing answer with explanation and conclusionarrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education