Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 21P
A mutant strain of Salmonella bacteria carries a mutation of the rho protein that has full activity at
a. Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at
b. Are all mRNAs affected by the rho protein mutation in the same way? Why or why not?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic mRNA?
a. If the mutation occurs in the 5' end of the start site, it will not affect the gene product.
b. If the mutation occurs in the exon, it will not affect the gene product.
c. If the mutation occurs in the splice site of a transcript with alternative splicing, only one gene product may
affected.
O d. If the mutation occurs in the intron or not in the splice site of a transcript with alternative splicing, it will nc
affect the gene product.
O e. If the mutation occurs in the 3' end of the start site, it will not affect the gene product.
OLIE STIC N 1A
The figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations.
3. The swo-1 a mutation (insertion between C and G).
4. The swo-1 b mutation (C-to-T mutation for indicated C).
5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.
Consider this sequence below:
GAG TAC ACG AGT GGA
Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!)
A. GAG TAC AAT CGA GTG GA
B. GAG TAC ACG GGT GGA
C. GAG TAC A–G AGT GGA
D. GAG TAC ACG AGA GGA
Chapter 8 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 8 - Prob. 1PCh. 8 - 8.2 In one to two sentences each, describe the...Ch. 8 - 8.3 Answer these questions concerning...Ch. 8 - 8.4 The diagram below shows a DNA duplex. The...Ch. 8 - The following is a portion of an mRNA sequence:...Ch. 8 - Compare and contrast the properties of DNA...Ch. 8 - The DNA sequences shown below are from the...Ch. 8 - Bacterial and eukaryotic gene transcripts can...Ch. 8 - Describe the two types of transcription...Ch. 8 - What is the role of enhancer sequences in...
Ch. 8 - Prob. 11PCh. 8 - Draw a bacterial promoter and label its consensus...Ch. 8 - For a eukaryotic gene whose transcription require...Ch. 8 - Three genes identified in the diagram as A, B and...Ch. 8 - Prob. 15PCh. 8 - 8.16 The segment of the bacterial gene involved in...Ch. 8 - Prob. 17PCh. 8 - Prob. 18PCh. 8 - 8.19 A DNA fragment from the end of the mouse...Ch. 8 - 8.20 Wild-type E. coli grow best at but can grow...Ch. 8 - A mutant strain of Salmonella bacteria carries a...Ch. 8 - 8.22 The human wild-type allele and a certain...Ch. 8 - Prob. 23PCh. 8 - A full-length eukaryotic gene is inserted into a...Ch. 8 - The accompanying illustration shows a portion of a...Ch. 8 - DNA footprint protection (described in Research...Ch. 8 - Suppose you have a 1-kb segment of cloned DNA that...Ch. 8 - Assume that a mutation affects the gene for each...Ch. 8 - 8.29 The DNA sequence below gives the first base...Ch. 8 - 8.30 Genomic DNA from a mouse is isolated,...Ch. 8 - 8.31 A portion of a human gene is isolated from...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Tryptophan synthase is one of the enzymes synthesized from the trp mRNA. In wild-type E. coli, the trp mRNA has a short half-life, but the tryptophan synthase half-life is much longer. To investigate how changes to the stability of the enzyme or its mRNA affect enzyme activity, two strains of E. coli were engineered. Strain A stabilizes the trp mRNA and strain B rapidly degrades tryptophan synthase. The wild-type, A, and B strains were grown in a medium with glucose as the sole carbon source. After several generations, tryptophan was added to all three cultures and tryptophan synthase activity was measured periodically. Note: Evaluate each condition as a simple model, where changes in the stability of trp mRNA or tryptophan synthase do not elicit secondary effects in the cells. Select the statements that describe the expected change in tryptophan synthase activity after the addition of tryptophan. In strain B, since both the trp mRNA and tryptophan synthase are rapidly degraded, the…arrow_forwardAnother thalassemic patient had a mutation leading to the production of an mRNA for the β chain of hemoglobin that was 900 nucleotides longer than the normal one. The poly(A) tail of this mutant mRNA was located a few nucleotides after the only AAUAAA sequence in the additional sequence. Propose a mutation that would lead to the production of this altered mRNA.arrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forward
- Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forwardThe following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.arrow_forwarda. In your claim words, depict the contrast between ρ-dependent and ρ-independent end of translation in prokaryotes. b. If you have a given amino acid, can you be able to identify its RNA? Why or why not? c. How does mutation can affect the central dogma and the phenotype?arrow_forward
- In 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments. A complex of which of the following components was trapped in the nitrocellulose filter? (More than one may apply). A. Synthetic mRNA B. DNA C. Anti-codons D. Radioactive amino acids E. Large ribosomal subunits F. Small ribosomal subunitsarrow_forwardA peptide is produced in two different cells. The primary structure is the same in both cells, but the amount of peptide is increased in one cell. What could be happening to the pre-mRNA or mRNA transcript within the cell that has the higher amount of this peptide? A. It has a shorter Poly-A tail B. An alternative polyadenylation (Poly-A) site is being selected C. Leaky scanning occurred D. B and C are both correct OE. None of the abovearrow_forwardChoose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post transcriptional processing Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for referencearrow_forward
- ) A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that changes the sequence to 5'- UGCCAUGGUUAAUAACACAUGAGGCGUGAAC-3'. Translate the original mRNA and the mutated mRNA and explain how insertion mutations can have dramatic effects on proteins. ( Hint; Be sure to find the initiation site).arrow_forwardNuclear (N) and cytoplasmic (C) mRNA samples of a gene with 2 exons and one intron run on an agarose gel along with a size marker, are shown in the gel figure below. Ntds = nucleotides 3. What is the length of the primary mRNA? HINT: Check question 3c RNA sample: N a. C ntds 1900- b. What is the length of the processed MRNA? 1250 1000 800- 650 с. If the 1250 nucleotide and 650 nucleotide fragments are spliced mRNA intermediates as indicated in the splicing diagram below, what is the size in nucleotides of Exon 1 & Exon 2. Size 1 Markers Exon Intran Exon pre-MRNA AG GU (1) (2) I spliced MRNA 2.arrow_forwardA geneticist induces a mutation in eukaryote cells. The mutation results in an inability to form the poly(A) tail during processing of pre-mRNA. What does this mean for the mature mRNA and what will be the effect on these cells? Possible Answers: A. The mRNA will be spliced, but will not have a 5' cap. B. The mRNA will likely be degraded. C. The mRNA will not be cleaved. D. The mRNA will have too many Gs and Cs.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY