Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 14P
Three genes identified in the diagram as A, B and C are transcribed from a region of DNA. The
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be the
complimentary RNA strand? Provide the direction as well as 5" and 3" indicators for the new genetic
genome.
5" G-A-A-C-T-G-G-A^T-T-C-T-A-C-C3'.
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’.
2a). Following transcription, what is the total number of codons in the mRNA transcript?
2 b). Where is the start codon located in this mRNA transcript?
2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
Given the following DNA sequence of the template strand for a given gene:
5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3'
Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends).
Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid.
Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
Chapter 8 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 8 - Prob. 1PCh. 8 - 8.2 In one to two sentences each, describe the...Ch. 8 - 8.3 Answer these questions concerning...Ch. 8 - 8.4 The diagram below shows a DNA duplex. The...Ch. 8 - The following is a portion of an mRNA sequence:...Ch. 8 - Compare and contrast the properties of DNA...Ch. 8 - The DNA sequences shown below are from the...Ch. 8 - Bacterial and eukaryotic gene transcripts can...Ch. 8 - Describe the two types of transcription...Ch. 8 - What is the role of enhancer sequences in...
Ch. 8 - Prob. 11PCh. 8 - Draw a bacterial promoter and label its consensus...Ch. 8 - For a eukaryotic gene whose transcription require...Ch. 8 - Three genes identified in the diagram as A, B and...Ch. 8 - Prob. 15PCh. 8 - 8.16 The segment of the bacterial gene involved in...Ch. 8 - Prob. 17PCh. 8 - Prob. 18PCh. 8 - 8.19 A DNA fragment from the end of the mouse...Ch. 8 - 8.20 Wild-type E. coli grow best at but can grow...Ch. 8 - A mutant strain of Salmonella bacteria carries a...Ch. 8 - 8.22 The human wild-type allele and a certain...Ch. 8 - Prob. 23PCh. 8 - A full-length eukaryotic gene is inserted into a...Ch. 8 - The accompanying illustration shows a portion of a...Ch. 8 - DNA footprint protection (described in Research...Ch. 8 - Suppose you have a 1-kb segment of cloned DNA that...Ch. 8 - Assume that a mutation affects the gene for each...Ch. 8 - 8.29 The DNA sequence below gives the first base...Ch. 8 - 8.30 Genomic DNA from a mouse is isolated,...Ch. 8 - 8.31 A portion of a human gene is isolated from...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The following four mutations have been discovered in a gene that has more than 60 exons and encodes a very large protein of 2532 amino acids. Indicate which mutation would likely cause a detectable change in the size of the mRNA and/or the size of the protein product. Consider a detectable change to be >10% of the wild-type size. A table of the genetic code is shown below. First letter 0 00 U O A บบบ UUC UUA UUG U CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu >Leu AUU AUC lle AUA AUG Met >Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala CAU CAC CAA CAG UAU UGU Tyr UAC UGC UAA Stop UGA UAG Stop UGG AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGGJ AGU AGC AGA AGG GGU GGC GGA GGG O AAG576UAG (changes codon 576 from AAG to UAG) Cys Stop Trp O GUG326AUG (changes codon 326 from GUG to AUG) Arg Ser Arg Gly DUAG DUA G DCAG DO AG deletion of codon 779 insertion of 1000 base pairs into the sixth intron (this particular…arrow_forwardThe following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.arrow_forwardThe following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. Draw or write-out a) the sequence of the primary transcript and b) the mature mRNA resulting from this stretch of DNA.arrow_forward
- The length of a particular gene in human DNA, measured from the start site for transcription to the end of the protein-coding region, is 10,000 nucleotides, whereas the length of the MRNA produced from this gene is 4000 nucleotides. What is the most likely reason for this difference? Explain in detail. For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). A Ix BIUS Paragraph Arial 14pxarrow_forwardThe following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?arrow_forwardThe following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold) a. What are the nucleotides of the mRNA from gene Z?b. What are the amino acids encoded by gene Z? (A codon chart is found on the finalpage)arrow_forward
- Shown below is the genomic structure of the human B-globin gene. The numbers within the boxes indicate the length in nucleotides of each region. Question 6: How many amino acids are present in the wild-type human B-globin protein? = exons = introns Transcription termination site (also poly A site) Promoter Start of transcription 3' 5' ATG 50 TẠC TAA 126 132 |ATT 90 130 222 850 3 5' Start codon Stop codon А. 438 В. 146 C. 620 D. 206 © 2013 John Wiley & Sons, Inc. All rights reserved.arrow_forwardShown below are three genes (gene 1, gene 2, and gene 3) located on the same bacterial chromosome. a) Indicate where on the diagram you would find the following for each gene: Promoter (p1 for gene 1, p2 for gene 2, and p3 for gene 3) Transcription termination site (tts1, tts2, and tts3) Start codon (start1, start2, and start3) Stop codon (stop1, stop2, and stop3) Template strand (ts1, ts2, and ts3), the DNA strand that directs RNA synthesis Be sure to indicate the component on the appropriate molecule (DNA or RNA).arrow_forwardIf the mRNA transcribed for this gene will be translated into a functional protein, how many amino acids will be used to build the polypeptide chain? what is the amino acid coded by the 25th codon? what is the amino acid coded by the last codon?arrow_forward
- If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding strand? Enter your answer below using the same format as shown here (three letters dash; repeat; and use no spaces). Table 26-1 The Genetic Code First Third Position Position (5'-end) Second Position (3'-end) A G UGU UGC UUU Phe UCU UCC Ser UAU Туr Тyr Stop Stop Cys Сys Stop Trp U UUC Phe Ser UAC C U UUA Leu UCA Ser UAA UGA UUG Leu UCG Ser UAG UGG G CUU CỤC CỦA Leu Leu Leu Leu CCU ССС ССА Pro Pro Pro Pro CAU САС САА CAG His His CGU Arg Arg Arg Arg U CGC CGA C Gln CUG CCG Gln CGG AUU Пе ACU Thr AAU Asn AGU Ser U AUC AUA Пе AUG* AAC AAA AAG Ile АСС Thr Asn AGC Ser C ACA ACG Thr Thr Lys Lys AGA AGG Arg Arg Met G GCU GUU GUC GUA GUG Val Val Val Val Ala GAU GẠC GAA GAG GGU Gly Gly Gly Gly U GCC GCA GCG Asp Asp Glu Glu Ala GGC C G Ala Ala GGA A GGG G *AUG also serves as the principal initiation codon.arrow_forward( plz give in detail )arrow_forwardShown below is the genomic structure of the human B-globin gene. The numbers within the boxes indicate the length in nucleotides of each region. = exons Transcription termination site (also poly A site) = introns Promoter Start of transcription 3' 5'. TAA ATG 50 TAC 130 222 850 126 132 90 ATT 5' 3 QUESTION 3: What is the length in nucleotides of the mature, processed B-globin mRNA? A.620 B.980 C.438 D.1600arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY