Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 26P
DNA footprint protection (described in Research Technique
a. Explain why this gel provides evidence that the cloned DNA may act as a promoter sequence.
b. Approximately what length is the DNA region protected by RNA pol II and TFIIs?
c. What additional genetic experiments would you suggest to verify that this region of cloned DNA contains a functional promoter?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Negative supercoiling of DNA favors the transcription of genes because it facilitates unwinding. However, not all promoter sites are stimulated by negative supercoiling. The promoter site for topoisomerase II itself is a noteworthy exception. Negative supercoiling decreases the rate of transcription of this gene. Propose a possible mechanism for this effect and suggest a reason why it may occur.
Telomerase activity has been found to be 10 to 20 times more active in cancer cells than in normal somatic cells. What is the significance of this circumstance?
Suppose you have a 1-kb segment of cloned DNA that is suspected to contain a eukaryotic promoter including a TATA box, a CAT box, and an upstream GC-rich sequence. The clone also contains a gene whose transcript is readily detectable. Your laboratory supervisor asks you to outline an experiment. (1) determine if eukaryotic transcription factors (TF) bind to the fragment and, if so, (2) identify where on the fragment the transcription factors bind. All necessary reagents, equipment, and experimental know-how are available in the laboratory.
Complete the outline of an experiment, which determines if eukaryotic transcription factors (TF) bind to the fragment. Assume all necessary reagents, equipment, and experimental how are available in the laboratory.
Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used.
For the band shift assay, two samples of the DNA fragment are analyzed by agarose gel electrophoresis: one sample is…
Chapter 8 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 8 - Prob. 1PCh. 8 - 8.2 In one to two sentences each, describe the...Ch. 8 - 8.3 Answer these questions concerning...Ch. 8 - 8.4 The diagram below shows a DNA duplex. The...Ch. 8 - The following is a portion of an mRNA sequence:...Ch. 8 - Compare and contrast the properties of DNA...Ch. 8 - The DNA sequences shown below are from the...Ch. 8 - Bacterial and eukaryotic gene transcripts can...Ch. 8 - Describe the two types of transcription...Ch. 8 - What is the role of enhancer sequences in...
Ch. 8 - Prob. 11PCh. 8 - Draw a bacterial promoter and label its consensus...Ch. 8 - For a eukaryotic gene whose transcription require...Ch. 8 - Three genes identified in the diagram as A, B and...Ch. 8 - Prob. 15PCh. 8 - 8.16 The segment of the bacterial gene involved in...Ch. 8 - Prob. 17PCh. 8 - Prob. 18PCh. 8 - 8.19 A DNA fragment from the end of the mouse...Ch. 8 - 8.20 Wild-type E. coli grow best at but can grow...Ch. 8 - A mutant strain of Salmonella bacteria carries a...Ch. 8 - 8.22 The human wild-type allele and a certain...Ch. 8 - Prob. 23PCh. 8 - A full-length eukaryotic gene is inserted into a...Ch. 8 - The accompanying illustration shows a portion of a...Ch. 8 - DNA footprint protection (described in Research...Ch. 8 - Suppose you have a 1-kb segment of cloned DNA that...Ch. 8 - Assume that a mutation affects the gene for each...Ch. 8 - 8.29 The DNA sequence below gives the first base...Ch. 8 - 8.30 Genomic DNA from a mouse is isolated,...Ch. 8 - 8.31 A portion of a human gene is isolated from...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…arrow_forwardImmortality of Stem cells is supported by the expression of telomerase that can extend the telomere sequence. However, one daughter cell created by division of stem cells will not be immortal due to lack of telomerase expression. What difference will you expect in regulation of the telomerase coding gene between the two daughter cells produced by cell division of stem cells? How might the cells be different in terms of chromatin structure at that loci?arrow_forwardThe pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never madearrow_forward
- What could be a probable fate of the segment of the DNA strand encircled in red? Polypeptides can now be translated from the encircled region as the two antiparrallel strands separate. The encircled DNA region can now be used as a template for transcription. it will relax right away on its own so that helicase can separate the two complementary strands with much ease If the encircled region will not be relaxed by another enzyme, it will experience supercoiling and will most likely break.arrow_forwardYou made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience. From this experiment you can conclude that: Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon). True or false: Spacer (a) -10 region -35 region TTGACA Consensus sequence TATAAT Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT (b) 700 600- 500- 400- 300- 200- 100. 0 ● True O False B-Galactosidase activity Wild-type…arrow_forwardAs described in Table, what is the difference between a rapidstop and a slow-stop mutant? What are different roles of the proteins that are defective in rapid-stop and slow-stop mutants?arrow_forward
- DNA polymerases are capable of editing and error correction, meaning it is able to edit and correct single base error so that the gene is not affected. However, RNA polymerase has a limited capacity for error correction. Given that a single base error in either replication or transcription can lead to error in protein synthesis, suggest a brief explanation for this difference in the capability of error correction between DNA polymerase and RNA polymerase.arrow_forwardYou isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the freshly-made and isolated hnRNA (primary transcript) from the nucleus of the mouse cells transcribed from the Tau gene (immediately after it was produced), allowing no time for processing of the hnRNA. Describe what you see when you look at the DNA/RNA hybrid molecule under the electron microscope.arrow_forwardProvide the type of cis acting sequence element or segmentsarrow_forward
- Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.arrow_forwardTransforming an Animal In order to create the transgenic cow, your lab first needs to create a DNA vector containing the insulin gene. This step involves a considerable amount of scientific terminology. Make sure you understand the meaning of key terms. Match the following terms with their correct definitions. | ampicillin resistance gene 5 restriction site 6 Origin of replication 7 Ligase 2 promoter 3 Xhol Ч ехоn is a region of DNA that is not transcribed. is the location in the plasmid that is recognized by the restriction enzyme Xhol. is an enzyme that joins DNA fragments together. is the location on the plasmid where DNA replication begins. is a region of DNA that initiates transcription of a gene. is an restriction enzyme that looks for the sequence TCGA. is a gene that enables you to identify bacterial cells that have taken up the plasmid.arrow_forwardA pyrimidine dimer which is a bulky lesion has mutated an E. coli cell's DNA. Describe both the photoreactivation enzyme repair (PRE) and Nucleotide excision repair describe how the cell uses Uvr A, B, C, D gene products to effect repair.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License