Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 25P
The accompanying illustration shows a portion of a gene undergoing transcription. The template and coding strands for the gene are labeled, and a segment of DNA sequence is given. For this gene segment:
a. Superimpose a drawing of RNA polymerase as it nears the end of transcription of the DNA sequence.
b. Indicate the direction in which RNA polymerase moves as it transcribes this gene.
c. Write the polarity and sequence of the RNA transcript from the DNA sequence given.
d. Identify the direction in which the promoter for this gene is located.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post transcriptional processing Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference
The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold)
a. What are the nucleotides of the mRNA from gene Z?b. What are the amino acids encoded by gene Z? (A codon chart is found on the finalpage)
The code for a fully functional protein is actually coming from an mRNA transcript that has undergone post-transcriptional processing which is essentially way too different from the original code in the DNA template.
Given: GUC-CAC-UUA-ACC-CCU-GAG-GAG-AAA-UCG-GCC (Protein with known amino acid sequence)
Requirement: Original DNA code. Itemize the steps you would take to get to know the original DNA code of the protein in focus.
Chapter 8 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 8 - Prob. 1PCh. 8 - 8.2 In one to two sentences each, describe the...Ch. 8 - 8.3 Answer these questions concerning...Ch. 8 - 8.4 The diagram below shows a DNA duplex. The...Ch. 8 - The following is a portion of an mRNA sequence:...Ch. 8 - Compare and contrast the properties of DNA...Ch. 8 - The DNA sequences shown below are from the...Ch. 8 - Bacterial and eukaryotic gene transcripts can...Ch. 8 - Describe the two types of transcription...Ch. 8 - What is the role of enhancer sequences in...
Ch. 8 - Prob. 11PCh. 8 - Draw a bacterial promoter and label its consensus...Ch. 8 - For a eukaryotic gene whose transcription require...Ch. 8 - Three genes identified in the diagram as A, B and...Ch. 8 - Prob. 15PCh. 8 - 8.16 The segment of the bacterial gene involved in...Ch. 8 - Prob. 17PCh. 8 - Prob. 18PCh. 8 - 8.19 A DNA fragment from the end of the mouse...Ch. 8 - 8.20 Wild-type E. coli grow best at but can grow...Ch. 8 - A mutant strain of Salmonella bacteria carries a...Ch. 8 - 8.22 The human wild-type allele and a certain...Ch. 8 - Prob. 23PCh. 8 - A full-length eukaryotic gene is inserted into a...Ch. 8 - The accompanying illustration shows a portion of a...Ch. 8 - DNA footprint protection (described in Research...Ch. 8 - Suppose you have a 1-kb segment of cloned DNA that...Ch. 8 - Assume that a mutation affects the gene for each...Ch. 8 - 8.29 The DNA sequence below gives the first base...Ch. 8 - 8.30 Genomic DNA from a mouse is isolated,...Ch. 8 - 8.31 A portion of a human gene is isolated from...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'arrow_forwardConsider this list (below) of steps involved in transcription. These steps are out of order. TRANSCRIPTION: 1. mRNA travels through a nuclear pore and enters the cytoplasm 2. the mRNA polymerase attaches at the start of a specific gene 3. RNA polymerase reads the gene surface4. a transcription factor bonds to a promoter site5. DNA molecule is unwound 6. a complimentary mRNA is produced What is the correct order of this transcription?arrow_forwardThe code for a fully functional protein is actually coming from an mRNA transcript that has undergone post-transcriptional processing which is essentially way too different from the original code in the DNA template. Given: Val-His-Leu-Thr-Pro-Glu-Glu (Protein with known amino acid sequence) Requirement: Original DNA code. Itemize the steps you would take to get to know the original DNA code of the protein in focus.arrow_forward
- Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forwardChoose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post transcriptional processing Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference 5’ CTATATTTATGTGCTATATCCAGGACTGCCCCTAGGAAATAAAAAA…AAAAAAA 3’3’ GATATAAATACACGATATAGGTCCTGACGGGGATCCTTTATTTTTT…TTTTTTT 5’arrow_forwardGiven the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)arrow_forward
- Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forwardYou are given the following mRNA sequence. You know that it contains some UTR sequence and the beginning of the coding sequence of a gene. 5’ ACGGUAUCUAUGGAUUCUGAGGUUGCUGCUUUGGUUAUU 3’ Part A: Write the amino acid sequence for this portion of the coding sequence. Part B: Write the double-stranded DNA sequence that corresponds to the mRNA above. Label 5’ and 3’ ends. Would transcription have occurred using the top or bottom strand as the template?arrow_forwardThe diagram below depicts an active transcription bubble after a short period of RNA synthesis during the transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the diagram. Motivate your answers. (i) the template and the non-template strands; (ii) the orientation (direction) of both DNA strands and that of the newly synthesised RNA strand; (iii) the location of a possible promotor sequence; (iv) the location of a possible Shine-Dalgarno sequence; (v) the specific area of activity of a RNA polymerase.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license