Concept explainers
Wild-type E. coli grow best at
a.
b.
c.
d. What term best characterizes the type of mutation exhibited by the mutant bacterial strain? (Hint: The term was used in Chapter
Want to see the full answer?
Check out a sample textbook solutionChapter 8 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
- In bacteria's transcription and translation, not all RNAS and proteins are produced at the same time and quantities. Access the condition of prokaryotic transcription below with suitable control methods. When E. coli is exposed to heat shock or grown at higher temperaturearrow_forwardEF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in prokaryotic translation. The sigma subunit of RNA polymerase is replaced by NusA to recognise the promoter region of a gene. The -10 and -35 sequences in E. coli DNA are referred to as untranslated region. In human, translation begins before transcription of an mRNA completes. this statement true or false.arrow_forwardThe lac operon consists of three structural genes, lacZ, lacY and lacA that are transcribed as a single polycistronic mRNA. The new lac strain of Escherichia coli are as shown below: P+O+Z+Y+A+// P+O+Z+Y+A¯ (i) Illustrate how lactose induces the gene expression in lac 1 $// I-. (ii) Explain the function of the lacP and laco in the bacterial operon.arrow_forward
- The lac operon consists of three structural genes, lacZ, lacY and lacA that are transcribed as a single polycistronic mRNA. You are given a new strain of Escherichia coli with the following lac operon genotype: p+0°Z•Y*A +// P*O*Z*Y+ A- (i) Explain how the lac I ³ gene affects gene expression.arrow_forwardThe 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E. coli. Even so, the riboswitch in B. subtilis regulates transcription, whereas the one in E. coli regulates translation. What is the role of the 5′ region in both riboswitches? How can one riboswitch regulate transcription while the other regulates translation?arrow_forwardA number of mutations affect the expression of the lac operon in E. coli. Consider each genotype below and complete the table using “+” to indicate that the gene is expressed, and “−” to indicate that gene is not expressed.arrow_forward
- A particular mutation in the bacterial sigma factor allows this protein to bind RNA polymerase but prevents it from coming off (detaching) RNA polymerase once it binds. What specific effect will this mutation have on transcription? It will prevent the transcription termination exerted by the Rho protein. It will prevent the formation of closed complexes between RNA polymerase and the promoter. It will prevent the formation of open complexes between RNA polymerase and the promoter. It will prevent the transition from the transcription initiation to the transcription elongation stage. It will prevent the synthesis of abortive RNA transcripts while the RNA polymerase is bound at the promoter.arrow_forwardConsider a mutant of E. coli that has an inactivating mutation in the gene for the catabolite activator protein (cap). Choose the compound(s) that could be provided to the mutant to achieve full transcription of the lac operon. If no combination of compounds can allow for transcription, chose none. ATP CAMP O glucose lactose nonearrow_forwardConsider a mutant of E. coli that has an inactivating mutation in the gene for adenylate cyclase (cya). Choose the compound(s) that could be provided to the mutant to achieve full transcription of the lac operon. If no combination of compounds can allow for transcription, chose none. O ATP O CAMP O glucose O lactose nonearrow_forward
- The most common type of termination signal in E. Coli is a symmetrical inverted repeat of GC rich sequences followed by about 7 As that forms a stable stem-loop structure in the RNA, which disrupts its association with the DNA template and terminates transcription. true or falsearrow_forwardTo characterize the promoter of the gadA operon you made a series of deletion mutants removing pieces of the promoter to see what would happen. The results are found below: gad promoter gada gadX gadz 450 +1 lacz activity transcription start site pH 2.0 pH 7.0 A gad promoter beta-galactosidase (lacZ) +++ 450 gad promoter beta galactosidase (lacZ) +++ +++ 300 +1 gad promoter beta galactosidase (lacZ) 150 D gad beta galactosidase (lacz) -450 150 E gad promoter beta-galactosidase (lacZ) -450 -300 Based on these results, what can you conclude about the gad promoter? O a. The promoter is only regulated by repression Ob. The promoter is regulated by a mix of activation and repression O c. The promoter is only regulated by activation O d. The promoter has multiple operators and multiple enhancersarrow_forwardThe following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education