Concept explainers
The human
a. Speculate about the way in which this base substitution causes mutation of
b. This is one example of how DNA sequence change occurring somewhere other than in an exon can produce mutation. List other kinds of DNA sequence changes occurring outside exons that can produce mutation. In each case, characterize the kind of change you would expect to see in mutant mRNA or mutant protein.
Want to see the full answer?
Check out a sample textbook solutionChapter 8 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
- Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and2 are 546 bp and 466 bp respectively.a. Draw this gene showing the promoter, exons, introns and transcription initiationsites.b. This gene is found to encode two mRNAs. One of these mRNAs is 224 bp in shorter thanthe other.i. What is the biological process giving rise to this phenomenon called?What are the sizes of the two mRNAs (in bp) produced from this gene?arrow_forwardSickle cell anemia is an example of a genetic disease caused by a point mutation. To answer this question look at the information in chapter 3 of the OpenStax book. If you use another resource that is fine but you will need to share the link. a. Describe the specific change in the nucleotide sequence sequence from normal to mutated hemoglobin. b. Describe the specific change in the amino acid sequence from normal to mutated hemoglobin. c. Explain the structural effect that this point mutation has on the hemoglobin protein. d. Explain how this mutation affects the function of the hemoglobin protein.arrow_forwardDNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene; the hybridized structure was then observed with an electron microscope. The adjoining diagram shows the structure that was observed. a. How many introns and exons are there in this gene? Explain your answer.arrow_forward
- Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forwardIn the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR gene is described as 583 AC (deletion of 1 nucleotide at position +583). At the protein level, the mutation would be described as: a. a nonsense b. a missense c.arrow_forwardSIM is toxic to E. coli. Ali has discovered that a novel prokaryote, C.bantaglia genome encodes for a protein, AIN that can degrade SIM. a. In steps, outline how you can construct this genomic library so that recombinant expression can be performed in E. coli? B. After the genomic library has been constructed you are tasked to describe in steps how you would isolate the DNA sequence that encodes for AIN?arrow_forward
- Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forwardPlease answer botharrow_forwardConsider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?arrow_forward
- Consider the following gene with their respective introns and exons 5’ – TCATGCATTTTGCGCGGGAAATAGCTCA – 3’ 3’ – AGTACGTAAAACGCGCCCTTTATCGAGT – 5’ Using the bottom as a template strand, create: A. A primary mRNA transcript B. A processed mRNA transcriptC. Highlight where your START and STOP codons are in your processed transcript (if there are any). D. The resulting protein sequencearrow_forwardHuntington disease (HD) can arise from a rare, short, in-frame addition of CAG nucleotide triplets within the huntingtin (HTT) gene coding region, which creates a disease-causing allele with the symptoms only appearing later in life. Using this information, describe an experiment that could be undertaken to determine whether a currently healthy young individual is a carrier of the HD-causing mutation. Describe the method you would use and how you would interpret the results of this experiment.arrow_forwardPerfect Day Foods is one company creating a synthetic milk alternative. It's similar to milk in that it consists of casein and whey, the proteins found in milk. However, a cow was never used to produce their product. Instead, the animal-free dairy product is made in a lab using yeast programmed with DNA to produce the same proteins found in cow’s milk. a. Describe the technology that was used to generate yeast programmed to produce milk proteins.arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning