Answered: 3. In your own words, describe how you…

Name: 3. In your own words, describe how you can determine on which side of
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 3. In your own words, describe how you can determine on which side of +1 the RNA transcript will be made, and how you determine the template strand?

Science

Biology

3. In your own words, describe how you can determine on which side of +1 the RNA transcript will be made, and how you determine the template strand?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section19.4: Genome Evolution

Problem 2SB

See similar textbooks

Similar questions

6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3'-TACT GACTG ACGAT C-5'. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each? 6.a. Mutated DNA Template Strand #1: 3'-TACTGTCT GACGATC-5' Complementary DNA sequence: mRNA sequence transcribed from template: Amino acid sequence of peptide: Type of mutation: 6.b. Mutated DNA Template Strand #2: 3'-TACG GACT GAC GATC-5' Complementary DNA sequence: mRNA sequence transcribed from template: Amino acid sequence of peptide: Type of mutation:
3. Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. The nucleotides are numbered 1 to 100. NOTE: For this problem, transcription begins with and includes the red and underlined C/G (top strand/bottom strand) base pair and RNA polymerase proceeds from left to right along the DNA. 1 20 40 5'-GTGTCCGTСТААТАТТGTGAGATGTТАТАТСССGCСGTCAАСАССАТСАА-3' +------- +------- ---------+ 3'-САСAGGCAGATTATAACAСТСТАСААТАTAGGGCGGCAGTTCTGGTAGTТ-5' 60 80 100 5'-ACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3' ------+ 3'-TGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG-5' a) Which strand is used as a template for transcription, the top or the bottom? b) Where would the promoter be relative to the start of transcription? c) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends of the mRNA. d) What…
4
17. Complete the following Central Dogma Grid Puzzles: First determine which DNA strand is the template (look at provided nucleotides). Label template and coding/sense (non-template) strand in first column. In the second column, label the 5' and 3' ends of DNA and RNA sequences and the amino (N) and carboxyl (C) ends of the polypeptide. The last four columns represent transcriptional and translational alignments (reading frame). This is from within a coding region so you don't have to find a start codon. Fill in all nucleotides and amino acids using the mRNA code table on the last page. a. On this first grid, assume that the DNA and RNA templates are read left to right. DNA strand C DNA strand G mRNA codon A U TRNA anticodon A polypeptide TRP
b. Now do this AGAIN assuming that the DNA and RNA templates are read right to left. DNA strand C DNA strand T G A MRNA codon C|A U TRNA anticodon G A polypeptide TRP
1. Are each of the following mutations silent, missense, nonsense, or frameshift mutations, why? The original coding DNA strand is: 5’-ATGGGACTAGATACC-3’. 2. 5’-ATGGGTCTAGATACC-3’ 3. 5’-ATGGGACTAAGATACC-3’ 4. 5’-ATGTGACTAGATACC-3’ 5. 5’-ATGGGACTAGTTACC-3’
5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?
11. Here is a short stretch of replicating DNA. The top strand is the template. Assume the 4.... are the RNA primers. Numbers «1, 2, 3, 4, indicate parts of fragments. Okazaki 5' 5. 3 a b. Which was made first, the Left or the Right fragment? Which primer will be the first to be removed, Left, Middle, or Right? When the primer in the middle is removed and filled in with DNA, the fragments must then be joined. Which enzyme joins the fragments? Where is the final connection made: a or b?
5. Below is an image of DNA sequenced using the Sanger sequencing method, where different nucleotides are labeled with different colors. Top of gel (shortest or longest DNA fragment?) a) Label the shortest and longest fragments on the gel by filling out the blank next to the image. ddGTP Labeled terminator ddCTP Nucleotides used in ddTTP sequencing reaction ddATP b) Determine the sequence of the original gene (hint: remember that the sequence is complimentary to the original gene because it is copied by PCR (via base pairing) prior to loading the gel). Gel sequence: Original Gene: + (shortest or longest DNA fragment?)
1. Fill in the blanks in the table below regarding the similarities and differences between DNA replication and transcription. DNA replication Transcription Polymerase moves along DNA template from 5' to 3' or 3' to 5'? What is the molecule synthesized? Is primase required? (Yes/ No) Polymerase has 3' to 5' exonuclease activity? (Yes/ No) Is the molecule synthesized complementary to the template? (Yes/ No)
8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the mRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' CCGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' mRNA 5' Protein Aline Valine Arginine partic Lysine Asparagine COTOCOAQUC. C FOU U G A Glycine Threonine A GUC A GU G Stop Step Cysteine GTryptophan Phenyl- sarine Lauche C Serie CROUCH UG A C U Hatidine Tyrosine 2060 20/ Leucine Proine
5. Design a 10-bp primer that could be used to amplify the following sequence of DNA: 5'-AGTCGATCCCTGATCGTACGCTACGGTAACGT-3'