1. Which of the following RNA has a catalytic activity like an enzyme?A. mRNAC. rRNAB. tRNAD. micro RNA2.What is the correct name of a nucleotide with the following constituents: Thymine + D-ribose + PO4?A. Deoxythymidine 5'-monophosphateB. Thymidine 5'-monophosphate3.What is the difference between A DNA and B DNA?C. Ribonucleothymidine 3'-monophosphateD. This nucleotide doesn't exist.A. They differ in orientationB. They differ in pitch4. Following the complementary base pairing rule, predict the percentage of T in a doublestranded DNA with 17% of C.A. 25%B. 30%5.If Guanine combines with deoxyribose, what compound is formed?C. GuanosineD. Guanine 3'-monophosphateA. Deoxyguanine 5'monophosphateB. DeoxyguanosineC. They differ in direction of coilingD. B and CC. 33%D. 35%

There are two types of nucleic acid found in living organisms DNA and RNA. Nucleic acids are the…

Answered: 1. Which of the following RNA has a…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

32. The molecule above is called HO 08-0 OH OH and it can be found in A) 3'-deoxyribose-5'-phosphate; RNA B) 2'-deoxyribose-5'-phosphate; RNA 3'-deoxyribose-5'-phosphate; DNA D) 2'-deoxyribose-5'-phosphate; DNA 33. The chromosomes we typically con in im OH
I think it’s all of the above but I am not sure please explain
1 starting with datp and dctp draw the synthesis of d(ac) dinucleotide. 2 draw the guanine nucleobase and label all possible H- bond donors and H - bond acceptors 3 Name three types of RNA and briefly describe how each function 4 The overall structure of dna is double helical and the bases between each strand from Watson Crick base pairs. Why does RNA make such different structure give two examples
1. For each of the items below, give a brief description (indicate function for enzymes) and indicate in which process (replication, transcription, or translation) it is involved with. helicase Description/Funetion catalyzes the unwinding of DNA strands Process involved in replication 11. terminator 12. ribosome 13. amino-acyl RNA site 14. MRNA 15. tRNA 16. rRNA 17. Shine-Dalgarno sequence 18. start codon 19. Okazaki fragments 20. coding strand 21. peptidyl tRNA site
If the anticodon on the tRNA is 3' GCC 5' , the amino acid added by tRNA synthetase will be? 1. P 2. R 3.A 4.G
1. A DNA fragment was sequenced; however, the scatter-brained professor lost track of the direction of the sequence. The resulting sequence is given, but without the 3' or 5' ends identified. NOTE the sequence listed is double stranded. (a) Find all START codons (in both directions and for both strands) and report the sequence of the two start codon(s) plus the next 3 bases downstream (i.e. 5' to 3' direction) (b) One of the start codons has a STOP codon 5 codons downstream, list the 18 bases that contain the target sequence and the 6 amino acids that this (very short) open reading frame would translate to (c) BONUS: Identify the 3' or 5' ends for lables1- 4 (1) ATATTAAAAAAGGTTTAGGTACGGAACGTCGAAGAGAACTAAACACAAATTAAGTGACAGACAGTTGTC (2) (3) TATAATTTTTTCCAAATCCATGCCTTGCAGCTTCTCTTGATTTGTGTTTAATTCACTGTCTGTCTACAG(4)
3. The data in the following table represent the base composition of two double stranded DNA sources and their RNA products in experiments conducted in vitro. A+T A+U A+G Species G+C G+C C+U Bacillus subtilis 1.36 |1.30 1.02 E. coli 1.00 |0.98 0.80 From the above data, is it possible to determine whether the RNA of these species is copied from a single strand or from both strands of the DNA? How? (HINT: Drawing a diagram may make it easier to solve this problem). Explain how it is possible to tell whether the RNA itselfis single stranded or double stranded.
Deaminated bases mut be removed from DNA because a- the mRNA formed may be irregular b-they pair incorrectly during repalication c-they distort the molecule d-they form thymine dimers
51 23. Suppose that a mutation occurs in the DNA sequence (indicated by a red nucleotide). 5 ATG GGA CCC CAT TCC GCC AAG GGG CAC TGA 3' 3 TAC CCT GGG GTA AGG CGG TTC CCC GTG ACT 5' Type the RNA sequence that would be produced by this template: 3′
1. In the sequence grid below, you will fill in all boxes with end polarity, nucleotide, or amino acid as described below. a. The column to the far left identifies the sequence type. Based on the nucleotides given, fill in the words "template" and "coding" (non-template) for the two DNA strands as soon as you figure out which is which. (hint: look at mRNA) b. In the second and last columns, write the polarity of the ends of each sequence (5', 3', N or C). c. The remaining columns represent transcriptional and translational alignments. Fill in all nucleotides, assuming that the template sequences in the table are read from LEFT to RIGHT d. Using the mRNA codon table provided on the next page, determine the polypeptide sequence. This sequence is from the middle of a coding sequence, therefore you do not need a start sequence. T DNA DNA mRNA codon tRNA anticodon polypeptide DNA DNA mRNA codon tRNA anticodon A C polypeptide GLY A C G e. Repeat steps 1a-1d, but now assume that the template…
A nucleotide consists of ____. a. a five carbon sugar, a nitrogenous base, and a phosphate group b. a six carbon sugar, a nitrogenous base, and a phosphate group c. a six carbon sugar, a nitrogenous acid, and a phosphate group d. a five carbon sugar, a nitrogenous acid, and a phosphate group e. a four carbon sugar, a nitrogenous acid, and a phosphate group

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS