1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?

Q: 14. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: 63. A student studying mutations found her amino acid chain was…

A: Genetic information is carried by genes to make proteins .  Process includes:-  I ) Transcription II…

Q: 23. Once a polypeptide chain has begun growing during protein synthesis, an incoming RNA carrying…

A: When protein synthesis has been started, each new amino corrosive is added to the lengthening chain…

Q: 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid…

A: The genetic code is a set of rules used by living cells to translate information encoded in genetic…

Q: 1. Create an inversion on your mini gene ... ? that results in an inversion. Sequence 5…

A: Short nucleotide sequences known as primers are used in the polymerase chain reaction in order to…

Q: II. Human methylguanine-DNA methyltransferase sequesters alkyl groups from damaged bases leading to…

A: The DNA replication process produces several errors that are fixed by repair enzymes to maintain the…

Q: uisCUntinuous 4. The sequence of base triplets on the coding strand of part DNA molecule is…

A: tRNA is a RNA molecule that helps in protein synthesis. tRNA forms base pair with complementary…

Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…

A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…

Q: DOUBLE-STRANDED SUGAR" PHOSPHATE A. B USUALLY SINGLE-STRANDED SUGAR PHOSPHATE * DEOXYRIBOSE *RIBOSE…

A: Nucleic acid are biological macromolecules that consists of genetic material . It is present in most…

Q: What is the nitrogen base only in RNA? O A OT O U C

A: Nucleotide basically are formed of phosphate group , Nitrogenous base and sugar . Nucleotide is…

Q: 1. What would be the amino acid sequence encoded by the mRNA 5' C C A U G A C G U C G G A U C A A U…

A: Only proline amino acid form as second codon is stop codon here

Q: Draw the structure of the deoxyribonucleotide formed by joining two deoxyguanosine 5'-phosphates…

A: Deoxyribonucleotide is a structure that is made up of three basic parts: a phosphate group, a…

Q: Fill in the following information for making the following polypeptide (the codon chart is below).…

A: The sequence of nucleotides in DNA or RNA makes up the genetic code. Codons are three-base groups…

Q: 7. Predict the bases that will pair with the following bases to form the complementary messenger…

A: There are basically 4 types of nitrogenous bases ATGC and in RNA thymine is replaced with Uracil.

Q: 6. Name the first complementary base from the 5' direction. Type your answer in ALL CAPITAL LETTERS.…

A: DNA acts as the genetic material in most organisms. DNA is composed of nitrogenous bases,…

Q: Fill in the banks for the relative percentage of bases in a DNA T C G A 13 Strand 1 12 Strand 2 The…

A: The bond that is present in between sugar and nitrogen bases is glycosidic bond. The bond that is…

Q: Name three parts of nucleotide 5. Name nitrogenous bases found in DNA and RNA 6. Discuss on the…

A: Since you have asked multiple questions, only the first three questions have been answered. Please…

Q: 5. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: point mutation - change in single nucleotide sequence which alter the amino acid .

Q: Cytosine Adenosine 5'- monophosphate Deoxycytidine 5'- monophosphate 1. a nucleoside Cytidine 2. a…

A: The nucleotides are the building blocks for the nucleic, that is, DNA (deoxyribonucleic acid) and…

Q: Question 3 Not yet answered Points out of 1.00 P Flag question Which of the following have…

A: Nucleic acids are the molecules that cells use to store, transfer and express genetic information.…

Q: 1. On paper, write out the first 30 bases in the middle of the page in order.  You want ensure you…

A: Disclaimer: "According to the guidelines of bartleby, only one question is to be answered. Please…

Q: 1. Why Phosphate bond is important in DNA or RNA structure? 2. Why G-C forms three hydrogen bonds…

A: Molecular biology is the branch of science that studies various biological molecules like nucleic…

Q: 2) Label the coding and the template strand in the table.

A: A                               G    A              C       T   T   A T C           T…

Q: It’s likely that mutation affects Prokaryotes more than Eukaryotes. 1. Can you think of why that…

A: Eukaryotic genes are composed of exons and introns. Prokaryotic genes do not contain any intron…

Q: Which of the following best describes this nucleic acid? 6. The diagram below shows a portion of a…

A: A single nitrogenous base in RNA (uracil) differes from that of DNA as DNA contains thymine instead…

Q: 4. If your nucleotide sequence is - Is this sequence DNA or RNA? Explain how you know. - What would…

A: To determine the complementary strand of a DNA sequence we need to understand the base-pairing rules…

Q: Yhich amino acid is considered to be hydrophilic? a. Methionine b. Alanine c. Glycine d. Threonine

A: Hydrophilic amino acids are those acids which are highly stable when present in water. They are…

Q: 2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC 5' АTG CТА СТС…

A: No, this mutation might not change the way in which the protein functions. In this mutation the…

Q: 3. How many amino acids are there in the polypeptide (protein)?

A: Introduction :- Amino acids are molecules that join together to form proteins. The building blocks…

Q: We are given a random DNA sequence (each of the 4 bases has equal probability of occurring at each…

A: The nucleotide triplet that encodes an amino acid is called a codon. Each group of three nucleotides…

Q: 9. After the polypeptide chain is formed, what or who helps it fold into its final,…

A: Since you have posted multiple questions, we will solve the first question for you. If you want any…

Q: 1. Draw the structure of the polyribonucleotide UAGCCUG. 2. Draw the structure of the…

A: Nucleotides are phosphoric acid esters of nucleosides (pentose sugar containing a nitrogenous base).…

Q: 1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: 11. Now imagine that a mutation occurred in the second T of the codon below and the T became a G.…

A: Introduction: The genetic macromolecule referred to as DNA is highly stable with regards to its base…

Q: If the first G changes to A what kind of mutation will happen? Show the change in amino acid…

A: When there is an error in the DNA sequence during replication it causes a change in the DNA…

Q: Some substitution mutation result in a malfunctioning protein but others do not. Why is this? 

A: A mutation is a change that occurs while copying or trying to replicate DNA molecules, resulting in…

Q: N- NH O=P-OCH, `NH, HN он 'N. O= P- OCH, NH, ОН 'N N. O= P-OCH, OH ОН

A: There are mainly two types of nucleic acids:- deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid…

A: DNA is a self replicating molecule. The process by which mRNA is produced from DNA is called…

Q: 10. Analyse the following DNA sequences and identify and explain the anomalies you observe. If there…

A: A nucleotide is the most fundamental component of nucleic acids (RNA and DNA). A sugar molecule…

Q: hi i need help with science homework if you do i give 5/5  if this sample is good i might even sign…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: 14. What is the difference between a deoxyribonucleotide and a dideoxyribonucleotide?   Question…

A: 14.ANSWER;-C)  A dideoxynucleotide is missing a 3'- hydroxyl group on its sugar. Explain;- The…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: Mutations in the DNA molecule are caused by a spontaneous alteration. After a synonym mutation, the…