Your DNA has been mutated! Carry out the following mutations, separately:a) In the original sequence, change the blue C (arrow 1) to a T. Transcribe and translate again.mRNA: 5' 3'amino acids (single-letter): b) In the original sequence, change the red C (arrow 2) to a G. Transcribe and translate again.mRNA: 5' 3'amino acids (single-letter): c) In the original sequence, change the purple G (arrow 3) to a T. Transcribe and translate again.mRNA: 5' 3'amino acids (single-letter): d) In the original sequence, delete the green G (arrow 4). Transcribe and translate again.mRNA: 5' 3'amino acids (single-letter): This image contains a sequence of DNA nucleotides from the 5' to 3' direction: **5' CTATAAGGGCGCAAATCCCTGCCAT 3'**Within this sequence, specific nucleotides are highlighted and labeled:1. A blue arrow labeled "1" points to a **C** nucleotide.2. A red arrow labeled "2" points to a **C** nucleotide.3. A purple arrow labeled "3" points to a **G** nucleotide.4. A green arrow labeled "4" points to a **G** nucleotide.The colored arrows and numbers denote specific positions or features in the DNA sequence that may be of interest for educational or analytical purposes. The image displays a codon chart, which is a key tool used in molecular biology to understand the genetic code. It helps in translating nucleotide sequences into amino acids, the building blocks of proteins.### Structure of the Codon Chart:- **Reading the Chart**: The chart is organized based on three positions (first, second, and third bases) corresponding to the RNA codon sequences.- **First Base**: Listed vertically on the left side of the chart. Includes the bases Uracil (U), Cytosine (C), Adenine (A), and Guanine (G).- **Second Base**: Indicated at the top, horizontally. Also includes the bases U, C, A, and G.- **Third Base**: Listed vertically on the right side of the chart. Same bases as the first.### Interpretation of Codons:- Each combination of the first, second, and third bases results in a specific amino acid or a stop signal. - **Examples**: - UUU or UUC codes for Phenylalanine (F). - AUG codes for Methionine (M), which is also the start codon. - UAA, UAG, and UGA are stop codons, signaling the end of protein synthesis.- The amino acids and stop signals are written at the intersection of the respective bases.### Amino Acids:- Abbreviated with both three-letter and one-letter codes.- For instance, Serine is indicated as Ser (S), and Glutamate as Glu (E).### Purpose of the Codon Chart:- Helps in gene expression studies and in understanding mutations that can affect protein synthesis.- Important for researchers and students in genetics, molecular biology, and related fields.This chart serves as a fundamental resource in genetics to decode the sequences of mRNA into functional proteins.

Name: Your DNA has been mutated! Carry out the following mutations, separate
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Your DNA has been mutated! Carry out the following mutations, separately:a) In the original sequence, change the blue C (arrow 1) to a T. Transcribe and translate again.mRNA: 5' 3'amino acids (single-letter): b) In the original sequence, change the