. The table opposite shows the standard (coding strand) DNA inlet codes for the 20 amino acids involved in protein synthen A section of DNA template strand is shown below 5'-CATCCAAATTGTTGCCCG-3' (a) Write down the sequence of amino acids formed when section of DNA is transcribed and translated.

Q: 1. For the DNA molecule shown below, the 3' Strand of DNA is transcribed into mRNA and then…

A: The creation of proteins from the hereditary data stored in DNA depends on the processes of…

Q: posite shows the standard (coding strand) for the 20 amino acids involved in protein r DNA template…

A: DNA is the genetic material present in the cell.

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: From the previous question regarding the insertion of an A base into the template strand: will this…

A: The transcription is the process of RNA synthesis from the DNA template. It is the first step of…

Q: Match the features to the labeled parts (Some may be used mutliple times, and not all labeled names…

A: Answer. A -  N terminus- A polypeptide synthesis proceeds from N- terminus to C-terminus and…

Q: DNA sense or template DNA sense or template mRNA tRNA protein 5', 3' amino or carboxyl 5' T A U A R…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: Coding strand of DNA, complimentary to the template strand 5' 3' A T G C T T G CA CATT G a GA A G A…

A: A molecule made up of two chains of a polynucleotide that generate a double helix by coiling around…

Q: Understand Reverse/forwards strands and reverse complementary strand 5’-GCATGCAT-3’ Write down the…

A: A series of bases in a nucleic acid can form a double-stranded arrangement by combining base pairs.…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: Remember when looking up a codon make sure it is in its mRNA form.   Below is a sample of a…

A: The spontaneous changes in the DNA that changes the original base sequence is called mutation. For…

Q: ws the standard (coding strand) DNA amino acids involved in protein synthesi plate strand is shown…

A: DNA replication is a process in which DNA itself form DNA . It is two stranded , ladder like and…

Q: Mutated DNA Sequence #3 T A C A C C T TAG C GACGACT... What's the mRNA sequence? (Circle the change)…

A: DNA sequencing is the process of determining the nucleic acid sequence in the order of the…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein…

A: Introduction :- Gene expression is the process of formation of response or functional part through a…

Q: Has 53' DNA polymerase activity [Choose] [Choose ] RNA polymerase DNA polymerase I Coats…

A: Replication is the first and most important stage in the central dogma of the cell machinery. In…

Q: Write out the resulting DNA molecules after the following double stranded DNA molecule is digested…

A: DNA stands for deoxyribonucleic and. It is the genetic material present in the cell.

Q: d. O b. protein coding DNA that is transcribed into RNA and then translated into protein O c.…

A: The non-coding DNA sequences are the part of an organism's genome that doesn't encode amino acid…

Q: 8. Determine the amino acid chain coded for by the following another A is added after the first…

A: Mutations are the changes in the DNA sequence that may lead to harmful results.Frameshift mutations…

Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…

A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…

Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: The RNA is produced from the template strand of DNA by the transcription process that occurs within…

Q: 3 The restriction endonuclease PstI cuts DNA symmetrically on both strands at the СTGCAG sequence:…

A: Restriction endonucleases are the enzymes that are used to form cuts inside the DNA molecule. It is…

Q: AKS 5c1: The process represented in the model involves the creation of a molecule that is…

A: Transcription is a process that helps convert the information in the DNA strand into RNA in the…

Q: Given the following coding sequence for DNA, provide the sequence of the complementary(template)…

A: A nucleotide is a biomolecule that consists of a nitrogenous base (either a purine or a pyrimidine),…

Q: Give

A: Introduction:- The central dogma of biological sciences explains how genetic information is…

Q: Adds nucleotides in in the 5' to 3' direction during transcription. [Select ] [ Select ] ligase…

A: RNA polymerase

Q: Explain why the following statement is true: RNA polymerase copies template DNA in the 3’ to 5’…

A: The DNA helix is unwound right before the active site for polymerization by the RNA polymerase,…

Q: It is a large complex ribonucleoprotein particle that chemically modifies the pre mRNA strand by the…

A: A ribonucleoprotein (RNP) is a complex of ribonucleic acid and RNA-binding protein.

Q: Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING:…

A: The template strand is from 3` 5` and a coding strand of DNA is from 5` to 3`. The synthesis of m…

Q: A certain section of the coding (sense) strand of some DNA looks like this: SATGTATATCTCCAGTTAG-3…

A: Alternation of DNA sequence or any other charge in the chromosome shape or number is considered as a…

Q: .  Locate the -10 region hexanucleotide sequence in the following coding strand of DNA.  Indicate…

A: Transcription is a process through which the template strand of the DNA transcribes into mRNA in the…

Q: 1. You are provided with the DNA sequence in the leading strand template. See item number 1 in…

A: DNA consist of two strands that run antiparallel to each other . Each strand of DNA consist of…

Q: Following is the nucleotide sequence in a segment of a strand of DNA 5'- AATTGGCTCTATAAT-3' Give the…

A: Adenine, thymine, guanine, and cytosine are the bases of the DNA. The mRNA is a single-stranded…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…

Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…

A: Introduction :  One of the earliest steps in gene expression is transcription. The transfer of…

Q: a.Write out the complementary strand to the following sequence. Begin with the 5' of the end of the…

A: The Nucleotides polymers that are responsible for determining and regulating the genetic…

Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…

A: Gene is a part of the DNA, located on a specific site on the chromosome and has a specific sequence…

Q: Template strand/Sense strand Coding strand/Antisense strand Region of DNA unwinding Region of DNA…

A: The sense strand, or template strand, is the only strand that is effectively employed as a template…

Q: Water can dissolve many substances including some big molecules such as proteins because of its…

A: Water is a transparent, odorless, tasteless, inorganic chemical substance. It is composed of…

Q: What item/s are true? 1. When the 3' -ATCGGCTAC-5' IS TRANSLATED THE COMPLEMENTARY STRAND…

A: DNA and RNA are important for cell function as DNA provide the information for the cell's…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.