Has 53' DNA polymerase activity [Choose] [Choose ] RNA polymerase DNA polymerase I Coats single-stranded DNA, prohibiting from beta subunit (sliding clamp) pairing with itself SSB (ssDNA-binding protein) DnaA protein Rho factor topoisomerase Has 5' 3' DNA exonuclease activity Seals nicks in DNA, using ATP Relaxes supercoiled DNA in front of replication fork Unwinds DNA double helix, using ATP hydrolysis Synthesizes RNA primer Binds to sequences in the origin of replication, unwinding the DNA, and allowing the helicase to be loaded Increases processivity of DNA pol III DnaB helicase Okazaki fragment Terminator primase DNA ligase [Choose] [Choose]

Has 53' DNA polymerase activity [Choose] [Choose ] RNA polymerase DNA polymerase I Coats single-stranded DNA, prohibiting from beta subunit (sliding clamp) pairing with itself SSB (ssDNA-binding protein) DnaA protein Rho factor topoisomerase Has 5' 3' DNA exonuclease activity Seals nicks in DNA, using ATP Relaxes supercoiled DNA in front of replication fork Unwinds DNA double helix, using ATP hydrolysis Synthesizes RNA primer Binds to sequences in the origin of replication, unwinding the DNA, and allowing the helicase to be loaded Increases processivity of DNA pol III DnaB helicase Okazaki fragment Terminator primase DNA ligase [Choose] [Choose]

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made
Match the enzyme on the left with its role in DNA replication DNA polymerase I helicase DNA ligase DNA polymerase III topoisomerase primase 72 W w# 3 E $ 4 R % 5 T A 6 MacBook Pro Y & 7 U * 8 replaces primers with DNA connects Okazaki fragments to form a continuous strand of DNA synthesizes short RNA fragments used to initiate DNA synthesis Uses the 3'OH of an RNA primer to synthesize the leading strand and Okazaki fragments keeps DNA from getting tangled up ahead of the replication fork "unwinds" the DNA double helix at the origin and replication forks 1 ( 9 X 0 0 P + 11 Next
Label the figure to assess your knowledge of DNA replication. Drag the appropriate labels to their respective targets Reset] Help Okazaki fragment DNA polymera ase DNA polymerase Nucleotide Leading strand Replication fork Stabilizing proteins Ligase Primase Helicase Lagging strand RNA primer IIIN
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
BONUS: Why do RNA viruses such as the COVID coronavirus, influenza virus and HIV have much higher mutation rates than DNA viruses such as Herpes viruses? O DNA polymerases which copy viral RNA have much higher mutation rates than RNA polymerases which copy viral DNA O RNA polymerases which copy viral RNA have much higher mutation rates than DNA polymerases which copy viral DNA RNA viral 60S ribosomes make many ore mutations than DNA viral 40S ribosomes O RNA viral gyrases make more mistakes than DNA viral helicases
Identify the various types of DNA repair mechanisms known to counteract the effects of UV radiation. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Reset Help SoS repair is dependent on a photon-activated enzyme that cleaves thymine dimers. excision repair is the process by which an endonuclease clips out UV-induced dimers, DNA photoreactivation repair polymerase III fills in the gap, and DNA ligase rejoins the phosphodiester backbone. recombinational repair uses the corresponding region on the umdamaged parental strand of the same polarity. is a process in E. coli that induces error-prone DNA replication in an effort to fill gaps by inserting random nucleotides.
Consider prokaryotes, choose the CORRECT enzyme/keyword for the following function/role: Removes RNA primer and replaces it with newly synthesized DNA. [ Select ]
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Below is a list of "solutions" to problems encountered when bacteria replicate DNA. Match the "solution" to the specific "problem" encountered during DNA replication ligase [Choose ] [Choose ] helicase using RNA as template to make DNA conversion of ds DNA into ss templates Primase synthesis of most of DNA replacement of RNA with DNA DNA Polymerase I relief of chromosome supercoiling synthesis of short RNA primer protection of ss DNA templates DNA Polymerase III covalent linkage of Okazaki fragments Bacterial Gyrase [ Choose ] SSBP's [ Choose ]
DNA Polymerase Holoenzyme IIlI is represented below. It consists of several domains with distinct functions. The structure capable of 5' to 3' DNA polymerization is represented by the letter and the structure capable of 3' to 5' exonuclease activity is represented by the letter B. -D DNA Pol II holoenzyme D; A А; С А;B А А; D В; D O O
Match the components of bacterial replication and transcription correctly. v [Choose ] Topoisomerase Il helicase loader RNA polymerase must accumulate enough for DNA replication to begin Single stranded binding protein sigma factor proteins of the RNA polymerase adds nucleotides to RNA transcript DnaA bacterial helicase DNA gyrase - needed for recognition of promoter site in transcription Beta clamp DNA polymerase Tau complex two alpha units, beta, beta prime, and omega Dnac [ Choose ) DnaB ( Choose]
Discuss DNA replication of prokaryotes and please mention all of the enzymes and components listed below. DNA Primase – DNA directed “RNA Pol” which inserts nucleoside triphosphates (NTPs) Primers are oligonucleotides; priming process is the formation of primers DNA Helicase – separates the DNA in advance of the replication fork (in E. coli DNA Helicase II); binds at AT-rich region of DNA; ATP then binds the helicase Single-stranded DNA-binding Protein (SSBP) – no enzymatic activity; does not consume ATP Topoisomerase – alter the supercoiling of double-stranded DNA DNA Ligase – nicking of strands done for replication to continue Okazaki fragments DNA Polymerase – removes primer via 5’ to 3’ exonuclease activity; comes again for 5’ to 3’ polymerization activity (closes the gap between Okazaki fragments) Prokaryotes DNA Pol I – auxiliary enzyme to DNA Pol III; repairs damage; capable of excising pyrimidine dimers; polymerization via single active site that can bind all 4 dNTPs;…