Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 35P
The two gels illustrated below contain dideoxynucleotideDNA
a. Write the DNA sequence of both alleles, includingstrand polarity.
b. Identify the template and nontemplate strands of DNA.
c. Write out the mRNA sequences encoded by each template strand, and underline the start codons.
d. Determine the amino acid sequences translated fromthese mRNAs.
e. What is the cause of the mutation?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.)
2. b) Is the top or bottom DNA strand the template strand?
Given the following Wild Type and Mutated DNA sequences:
1.) Identify where the base pair change occurs ( what letter changed?)
2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences.
3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein.
Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5'
Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region.
5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^
Which strand is the template strand for transcription of this gene? Briefly explain how you know.
An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur?
A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
Chapter 12 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 12 - 11.1 Identify two general ways chemical mutagens...Ch. 12 - 11.2 Nitrous acid and (BU) alter DNA by different...Ch. 12 - 11.19 Using the adeninethymine base pair in this...Ch. 12 - The partial amino acid sequence of a wild-type...Ch. 12 - 5. Thymine is usually in its normal, common form....Ch. 12 - Ultraviolet (UV) radiation is mutagenic.
What...Ch. 12 - Researchers interested in studying mutation and...Ch. 12 - The effect of base - pair substitution mutations...Ch. 12 - Prob. 9PCh. 12 - 11.10 In numerous population studies of...
Ch. 12 - 11.11 Two different mutations are identified in a...Ch. 12 - 11.22 Many human genes are known to have homologs...Ch. 12 - 11.13 Answer the following questions concerning...Ch. 12 - Prob. 14PCh. 12 - Prob. 15PCh. 12 - Prob. 16PCh. 12 - 11.15 A sample of the bacterium is exposed to...Ch. 12 - 11.16 A strain of is identified as having a null...Ch. 12 - Define gene conversion and contrast it with gene...Ch. 12 - Prob. 20PCh. 12 - Prob. 21PCh. 12 - Prob. 22PCh. 12 - Prob. 23PCh. 12 - Prob. 24PCh. 12 - 25. If homologous recombination did not occur,...Ch. 12 - In this chapter, three features of genes or of DNA...Ch. 12 - Briefly compare the production of DNA double -...Ch. 12 - During mismatch repair, why is it necessary to...Ch. 12 - 11.27 Following the spill of a mixture of...Ch. 12 - A geneticist searching for mutations uses the...Ch. 12 - A wild - type culture of haploid yeast is exposed...Ch. 12 - A fragment of a wild - type polypeptide is...Ch. 12 - Prob. 33PCh. 12 - 11.40 Common baker’s yeast () is normally grown at...Ch. 12 - 11.41 The two gels illustrated below contain...Ch. 12 - Alkaptonuria is a human autosomal recessive...Ch. 12 - 11.33 In an experiment employing the methods of...Ch. 12 - Using your knowledge of DNA repair pathways choose...Ch. 12 - 11.35 Ataxia telangiectasia is a human inherited...Ch. 12 - 40. Two haploid strains of fungus are fused to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forwardSanger sequencing (aka the chain termination) a. is a method for for determining the sequence of nucleotides in a piece of DNA of intrest. b. requires use of special ddNTPs (dideoxy nucleotides) that have special florecent lables (dyes) attached to them and also lack a 3' hydroxyl. c. requires fragments to be run through a tube containing a gel matrix where their fluorescent dyes are illuminated with a laser, which can be used to produce a chromatogram. d. all of the above are true e. none of the above are truearrow_forwardYou isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the freshly-made and isolated hnRNA (primary transcript) from the nucleus of the mouse cells transcribed from the Tau gene (immediately after it was produced), allowing no time for processing of the hnRNA. Describe what you see when you look at the DNA/RNA hybrid molecule under the electron microscope.arrow_forward
- Consider the following gene with their respective introns and exons 5’ – TCATGCATTTTGCGCGGGAAATAGCTCA – 3’ 3’ – AGTACGTAAAACGCGCCCTTTATCGAGT – 5’ Using the bottom as a template strand, create: A. A primary mRNA transcript B. A processed mRNA transcriptC. Highlight where your START and STOP codons are in your processed transcript (if there are any). D. The resulting protein sequencearrow_forwarda. Given the following restriction map of a cloned 10 kb piece of DNA, what size fragments would you see after digesting this linear DNA fragment with each of the enzymes or combinations of enzymes listed: (1) EcoRI, (2) BamHI, (3) EcoRI + HindlII, (4) BamHI + Psl, and (5) EcoRI + BamHI. b. What fragments in the last three double digests would hybridize with a probe made from the 4 kb BamHI fragment? E HH E ++ + 1.5 0.6 1.0 1.2 B E + 2.1 1.9 1.7 kbarrow_forwardSuppose that the diagram below represents the genomic organization of an enzyme involved in eye pigment production in mice. Within the gene are four exons. Biochemical analysis has revealed that the active site of the enzyme is located in the C terminus of the protein. -The nucleotide length of each exon and intron is shown. -The dinucleotide sequence GT represents the 5’ splice site and the dinucleotide sequence AG represents the 3’ splice site. Both the 5’ and the 3’ splice sites must be present for splicing to occur. Assume that the first and second stop codons are located immediately after the first and second 5’ splice sites, respectively; the third and fourth stop codons are located near the 3’ end of exons 3 and 4, respectively; all these stop codons are in the correct reading frame. a) draw what the processed mRNA will look like. Include the start codon on the mRNA and label the approximate locations of the 5’ UTR and 3’ UTR on the transcript. (You do not need to add the 5’ CAP…arrow_forward
- A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain genearrow_forwarda. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? b. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? c. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence? d. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?arrow_forward11) Examine the following two DNA sequences. Sequence 1: ATGCGATGCTAGCAT Sequence 2: ATGCGATGATAGCAT If both of these sequences code for proteins, how might the function of protein 2 differ from the function of protein 1? Use the table below for assistance. U C A G บบน UUC UUA UUG CUU CUC CUA CUG U Phe GUUT GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met or Start Val Ceweg 232 www... UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG C GCU GCC GCA GCG Ser Pro Thr Ala CAU CAC CAA CAG A AAU AAC AAA AAG UAU U UAC C UAA Stop UGA Stop A UAG Stop UGG Trp G Tyr GAA GAG His Gin Asn Lys GAU GAC Asp G c] Glu UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cys Arg Ser Arg Gly U C A G U C A G U C A G by Calin me press A) Protein 1 and protein 2 will function exactly the same. B) Protein 1 will be shorter than protein 2, so they will not function the same. C) Protein 2 will be shorter than protein 1, so they will not function the same. D) Protein 2 has a different sequence, so it will function…arrow_forward
- Draw the structure of a dideoxynucleotide that would be used for DNA sequencing, and explain why they result in chain termination. Write out the sequence of the first 20 nucleotides for the gene shown in the sequencing gel below (remember to start at the bottom of the gel and work upward, from smallest to largest fragments).arrow_forwardIn the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) 5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Normal Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation Nonsense mutation Frameshift mutations Missense mútationarrow_forwardComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acidarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY