Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 12, Problem 3P
Using the adenine
a. Give the sequence after a transition mutation.
b. Give the sequence after a transversion mutation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Match the correct terms with its definition A. Transcription B. Translation C. Amino acid D. Dehydration ..........1. Process of producing a polypeptide from mRNA. ..........2. Process that forms messenger RNA from a DNA gene. ..........3. RNA polymerase is continuous by adding nucleotides complementary to the DNA template. ..........4. Small ribosome subunit binds to mRNA, and tRNA enters the P active site on the ribosome. ..........5. Processes of monomers are linked together to synthesize a biological polymer. ..........6. The building blocks of protein.
Consider the following segment of DNA, which is part of a linear chromosome:
LEFT 5’.…TGACTGACAGTC….3’
3’.…ACTGACTGTCAG….5’ RIGHT
During RNA transcription, this double-strand DNA molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. _____________ is the template strand for the synthesis of RNA? The sequence of the newly transcribed mRNA is _________________.
Question 5 options:
The top strand, 5'...GACUGUCAGUCA...3'
The bottom strand, 5'...ACUCACUCUCAG...3'
The top strand, 5'...UGACUGACAGUC...3'
The bottom strand, 5'...GACUGUCAGUCA...3'
Which DNA strand will serve as the template strand during the transcription of the RNA-coding sequence?
Chapter 12 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 12 - 11.1 Identify two general ways chemical mutagens...Ch. 12 - 11.2 Nitrous acid and (BU) alter DNA by different...Ch. 12 - 11.19 Using the adeninethymine base pair in this...Ch. 12 - The partial amino acid sequence of a wild-type...Ch. 12 - 5. Thymine is usually in its normal, common form....Ch. 12 - Ultraviolet (UV) radiation is mutagenic.
What...Ch. 12 - Researchers interested in studying mutation and...Ch. 12 - The effect of base - pair substitution mutations...Ch. 12 - Prob. 9PCh. 12 - 11.10 In numerous population studies of...
Ch. 12 - 11.11 Two different mutations are identified in a...Ch. 12 - 11.22 Many human genes are known to have homologs...Ch. 12 - 11.13 Answer the following questions concerning...Ch. 12 - Prob. 14PCh. 12 - Prob. 15PCh. 12 - Prob. 16PCh. 12 - 11.15 A sample of the bacterium is exposed to...Ch. 12 - 11.16 A strain of is identified as having a null...Ch. 12 - Define gene conversion and contrast it with gene...Ch. 12 - Prob. 20PCh. 12 - Prob. 21PCh. 12 - Prob. 22PCh. 12 - Prob. 23PCh. 12 - Prob. 24PCh. 12 - 25. If homologous recombination did not occur,...Ch. 12 - In this chapter, three features of genes or of DNA...Ch. 12 - Briefly compare the production of DNA double -...Ch. 12 - During mismatch repair, why is it necessary to...Ch. 12 - 11.27 Following the spill of a mixture of...Ch. 12 - A geneticist searching for mutations uses the...Ch. 12 - A wild - type culture of haploid yeast is exposed...Ch. 12 - A fragment of a wild - type polypeptide is...Ch. 12 - Prob. 33PCh. 12 - 11.40 Common baker’s yeast () is normally grown at...Ch. 12 - 11.41 The two gels illustrated below contain...Ch. 12 - Alkaptonuria is a human autosomal recessive...Ch. 12 - 11.33 In an experiment employing the methods of...Ch. 12 - Using your knowledge of DNA repair pathways choose...Ch. 12 - 11.35 Ataxia telangiectasia is a human inherited...Ch. 12 - 40. Two haploid strains of fungus are fused to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- . a. What are all the transversions that can be made starting with the codon CGG?b. Which of these transversions will be missense? Canyou be sure?arrow_forwarda. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?arrow_forwardConsider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?arrow_forward
- We have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.arrow_forwardThe DNA sequence below is from the center of a protein coding region. 5 10 15 20 25 30 5’ …… TATCC TAGAG CATAA TTTCG AGATA GCTAG …… 3’ 3’ …… ATAGG ATCTC GTATT AAAGC TCTAT CGATC …… 5’ a) Which strand is coding strand? b) What is the sequence of the encoded polypeptide? A mutant gene has GC (bold) to TA substitution @ position 20. c) What is the sequence of the mutant polypeptide d) What effect is the mutation likely to have on function of the protein? Explain with reasoning.arrow_forwardif you have the following sequence of DNA 5' ATTGCGGAGCCTCGAT 3' do the following:arrow_forward
- 1- The protein biosynthesis process begins with the presence of an enzyme ..........? B)DNA Polymerase A)RNA Polymerase 2-The process of DNA cloning requires the presence of ................? A)RNA Polymerase I B)RNA Polymerase IIarrow_forwardIf the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forward29. Huntington disease results from expansion of a CAG triplet within the first exon of the huntingtin (HD) gene. This genetic defect most likely results in which of the following? DA) Abnormal polyglutamine tract within the huntingtin protein B) Abnormal splicing of huntingtin mRNA C) Decreased transcription of huntingtin mRNA D) Premature translation termination E) Shifted translation frame inedarrow_forward
- a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forwardI mutation occurs such that the sequence now reads: CTA CTT TTT. A) Transcribe the short DNA sequence. B) translate this short DNA sequence. C) what type of point mutation is this? A mutation occurs such that the sequence now reads: CTA GTC TTT. 1)transcribe this short DNA sequence. 2. Translate this short DNA sequence. 3. What type of point mutation is this?arrow_forwardWhat is the result when the core histones are acetylated via histone acetyltransferase? A) The result depends on which histone is modified. B) The DNA becomes more tightly associated with the core. O C) The DNA becomes less associated with the core. This modification has no effect on how tightly associated DNA will become with the core.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License