Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 18P
A strain of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A scientist is researching GS1, an enzyme with a relative molecular mass (Mr) of 78,000 present in a bacterium. The scientist has isolated two mutant strains of the bacterium as described below.
Strain A: In this strain the GS1 protein is completely non-functional. Analysis of strain A shows that it produces a shortened GS1 protein with an Mr of only 38,000.
Strain B: This produces functional GS1, but the Kcat is somewhat reduced. Analysis shows it produces a lengthened form of GS1, with an Mr of about 86,000.
What type(s) of mutation may have occurred in the GS1 gene in strain A?
A scientist is researching GS1, an enzyme with a relative molecular mass (Mr) of 78,000 present in a bacterium. The scientist has isolated two mutant strains of the bacterium as described below.
Strain A: In this strain the GS1 protein is completely non-functional. Analysis of strain A shows that it produces a shortened GS1 protein with an Mr of only 38,000.
Strain B: This produces functional GS1, but the Kcat is somewhat reduced. Analysis shows it produces a lengthened form of GS1, with an Mr of about 86,000.
The scientist determines the nucleotide sequence of the coding strand of the GS1 gene from strain A. It is identical to the GS1 sequence from the wild type gene except for a single change occurring approximately 1⁄3 of the way into the GS1 open reading frame. A small region of the GS1 sequence (including the site where the mutation occurs) from the wild type and mutant strains is shown below.
Wild type TGTCCTCGGCCACAAGTTCTCTATC
Strain A TGTCCTCGGCCACTAGTTCTCTATC
How has this…
A scientist is researching GS1, an enzyme with a relative molecular mass (Mr) of 78,000 present in a bacterium. The scientist has isolated two mutant strains of the bacterium as described below.
Strain A: In this strain the GS1 protein is completely non-functional. Analysis of strain A shows that it produces a shortened GS1 protein with an Mr of only 38,000.
Strain B: This produces functional GS1, but the Kcat is somewhat reduced. Analysis shows it produces a lengthened form of GS1, with an Mr of about 86,000.
Sequencing of the GS1 gene from strain B shows that it is identical to the wild type gene except for a single alteration (the replacement of one nucleotide by another). How might this account for the features of the GS1 protein produced by strain B?
Chapter 12 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 12 - 11.1 Identify two general ways chemical mutagens...Ch. 12 - 11.2 Nitrous acid and (BU) alter DNA by different...Ch. 12 - 11.19 Using the adeninethymine base pair in this...Ch. 12 - The partial amino acid sequence of a wild-type...Ch. 12 - 5. Thymine is usually in its normal, common form....Ch. 12 - Ultraviolet (UV) radiation is mutagenic.
What...Ch. 12 - Researchers interested in studying mutation and...Ch. 12 - The effect of base - pair substitution mutations...Ch. 12 - Prob. 9PCh. 12 - 11.10 In numerous population studies of...
Ch. 12 - 11.11 Two different mutations are identified in a...Ch. 12 - 11.22 Many human genes are known to have homologs...Ch. 12 - 11.13 Answer the following questions concerning...Ch. 12 - Prob. 14PCh. 12 - Prob. 15PCh. 12 - Prob. 16PCh. 12 - 11.15 A sample of the bacterium is exposed to...Ch. 12 - 11.16 A strain of is identified as having a null...Ch. 12 - Define gene conversion and contrast it with gene...Ch. 12 - Prob. 20PCh. 12 - Prob. 21PCh. 12 - Prob. 22PCh. 12 - Prob. 23PCh. 12 - Prob. 24PCh. 12 - 25. If homologous recombination did not occur,...Ch. 12 - In this chapter, three features of genes or of DNA...Ch. 12 - Briefly compare the production of DNA double -...Ch. 12 - During mismatch repair, why is it necessary to...Ch. 12 - 11.27 Following the spill of a mixture of...Ch. 12 - A geneticist searching for mutations uses the...Ch. 12 - A wild - type culture of haploid yeast is exposed...Ch. 12 - A fragment of a wild - type polypeptide is...Ch. 12 - Prob. 33PCh. 12 - 11.40 Common baker’s yeast () is normally grown at...Ch. 12 - 11.41 The two gels illustrated below contain...Ch. 12 - Alkaptonuria is a human autosomal recessive...Ch. 12 - 11.33 In an experiment employing the methods of...Ch. 12 - Using your knowledge of DNA repair pathways choose...Ch. 12 - 11.35 Ataxia telangiectasia is a human inherited...Ch. 12 - 40. Two haploid strains of fungus are fused to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Let’s suppose you make a transposon library of the cellulose-secreting bacterium Komagataeibacter xylinus, with the goal of finding mutants that produce higher than normal amounts of cellulose, which would be useful industrially. However, despite your best efforts you are unable to isolate any transposon mutants that make more cellulose than the wild-type strain.Why might this have failed? List as many reasons as you can think of.arrow_forward1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also charged methionine tRNAs with alanine? b)What would happen if an individual was homozygous for mutant alleles of the gene encoding the aminoacyl tRNA synthetase responsible for charging leucine tRNAs?arrow_forwardYou are studying the tryptophan synthetase gene that Yanofsky also examined to determine the relationship between the nucleotide sequence and the amino acid sequence of the gene. Yanofsky found a large number of mutations that affected the tryptophan synthetase gene. A) If you took this mutant E. Coli line (that has an Arginine at this location) and exposed it to a mutagen that could potentially change bases, what are the second mutations you would most likely discover that would restore the activity of the tryptophan synthetase gene and where would it be located? B) Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also recovered a nonsense mutation that changed amino acid number 15 into a stop codon. This codon normally encodes Lysine. Does the recovery of this mutation support the hypothesis that this Lysine residue is critical in the function of the tryptophan synthetase protein?arrow_forward
- Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?arrow_forwardIf an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?arrow_forwardWe have two specific strains of E. coli that have shown horizontal gene transfer (HGT) when mixed. To experimentally determine the method of HGT that is happening, the following conditions are set up in different tubes of culture media: A) Donor and recipient strain mixed together (control - no treatment). B) Donor and recipient strains mixed together, DNase added (can digest DNA in solution, not within cells).C) Special tube containing a membrane filter (with pores that allow DNA and viruses to pass through, but not bacterial cells) that separates two compartments. Donor strain is added on one side, the recipient strain on the other (they are separated by the filter).D) Donor and recipient strains mixed together, with chemical that inactivates viruses (chemical affects bacteriophages in solution so they are unable to attach to cells). The results: Tubes A, B, and D: HGT was observed. Tube C: HGT was NOT observed. Based on this, which type of HGT was occurring? Conjugation,…arrow_forward
- Xeroderma pigmentosum is a genetic disease caused by an error in the nucleotide excision repair process that fixes damage to DNA by ultraviolet light. Studies have shown that it can result from mutations in any one of seven genes. What can you infer from this finding? A) There are seven genes that produce the same protein B) These seven genes are the most easily damaged by ultraviolet light. C) There are seven enzymes involved in the nucleotide excision repair process. D) These mutations have resulted from translocation of gene segments.arrow_forwardBelow is the DNA base sequence for the normal protein for normal hemoglobin and the base sequence for (abnormal) sickle cell hemoglobin: Normal GGG CTT CTT TTT Sickle GGG CAT CTT TTT A)Transcribe and translate the normal and sickle cell DNA. B)Identify this as a point or frameshift mutation. Explain.arrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainarrow_forward
- As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explainarrow_forwardFigure 2 illustrates a type of gene mutation. a) State the type of gene mutation shown in Figure 2. b) Name the genetic disorder that would arise from this mutation. c) What is the difference(s) between gene mutation shown in Figure 2 from a frameshift mutation?arrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY