Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 26P
In this chapter, three features of genes or of DNA sequence that contribute to the occurrence of mutational hotspots were described. Identify those three features and briefly describe why they are associated with mutational hotspots.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
There are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence of the light-colored wild-type Mc1r gene with the DNA sequence of the dark-colored mutant Mc1r gene. Indicate the locations of the five mutations by changing the font color to YELLOW for the five single DNA nucleotides that are mutated in the mutant Mc1r gene table. Using the information in the introduction, determine whether each of these mutations is a silent, missense, or nonsense mutation.
Using the mutant Mc1r gene data, fill in the columns (including DNA, mRNA, and amino acid) in gene table 2 that contain a silent mutation with BLUE.
Likewise, fill in the columns that contain a missense mutation with RED.
Shade any columns that contain nonsense mutations with GREEN.
Then
Of the five mutations you identified in the mutant Mc1r gene, how many are:
substitutions insertions deletions (Enter a number on each line.)
2. Of the five mutations…
There are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence of the light-colored wild-type Mc1r gene with the DNA sequence of the dark-colored mutant Mc1r gene. Indicate the locations of the five mutations by changing the font color to YELLOW for the five single DNA nucleotidesthat are mutated in the mutant Mc1r gene table. Using the information in the introduction, determine whether each of these mutations is a silent, missense, or nonsense mutation.
Using the mutant Mc1r gene data, fill in the columns (including DNA, mRNA, and amino acid) in gene table 2 that contain a silent mutation with BLUE.
Likewise, fill in the columns that contain a missense mutation with RED.
Shade any columns that contain nonsense mutations with GREEN.
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
Chapter 12 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 12 - 11.1 Identify two general ways chemical mutagens...Ch. 12 - 11.2 Nitrous acid and (BU) alter DNA by different...Ch. 12 - 11.19 Using the adeninethymine base pair in this...Ch. 12 - The partial amino acid sequence of a wild-type...Ch. 12 - 5. Thymine is usually in its normal, common form....Ch. 12 - Ultraviolet (UV) radiation is mutagenic.
What...Ch. 12 - Researchers interested in studying mutation and...Ch. 12 - The effect of base - pair substitution mutations...Ch. 12 - Prob. 9PCh. 12 - 11.10 In numerous population studies of...
Ch. 12 - 11.11 Two different mutations are identified in a...Ch. 12 - 11.22 Many human genes are known to have homologs...Ch. 12 - 11.13 Answer the following questions concerning...Ch. 12 - Prob. 14PCh. 12 - Prob. 15PCh. 12 - Prob. 16PCh. 12 - 11.15 A sample of the bacterium is exposed to...Ch. 12 - 11.16 A strain of is identified as having a null...Ch. 12 - Define gene conversion and contrast it with gene...Ch. 12 - Prob. 20PCh. 12 - Prob. 21PCh. 12 - Prob. 22PCh. 12 - Prob. 23PCh. 12 - Prob. 24PCh. 12 - 25. If homologous recombination did not occur,...Ch. 12 - In this chapter, three features of genes or of DNA...Ch. 12 - Briefly compare the production of DNA double -...Ch. 12 - During mismatch repair, why is it necessary to...Ch. 12 - 11.27 Following the spill of a mixture of...Ch. 12 - A geneticist searching for mutations uses the...Ch. 12 - A wild - type culture of haploid yeast is exposed...Ch. 12 - A fragment of a wild - type polypeptide is...Ch. 12 - Prob. 33PCh. 12 - 11.40 Common baker’s yeast () is normally grown at...Ch. 12 - 11.41 The two gels illustrated below contain...Ch. 12 - Alkaptonuria is a human autosomal recessive...Ch. 12 - 11.33 In an experiment employing the methods of...Ch. 12 - Using your knowledge of DNA repair pathways choose...Ch. 12 - 11.35 Ataxia telangiectasia is a human inherited...Ch. 12 - 40. Two haploid strains of fungus are fused to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Two types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.arrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)arrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics?arrow_forward
- Leber Congenital Amaurosis (LCA) causes progressive vision loss due to defects in the gene that encodes RPE65 isomerase. Affected individuals are homozygous recessive for mutant alleles of the RPE65 gene. You are trying to determine the molecular nature of the mutations in three individuals with LCA. For ease of analysis, you may assume that each individual is homozygous for the same mutant allele (though the three individuals have different mutations than each other). You use the polymerase chain reaction to amplify DNA from each patient and you determine the sequence of the DNA and compare it to unaffected individuals. You identify the following differences. Note that the non-template strand of DNA is given and the changes are highlighted using red boldface. You can assume that the sequences are in the first reading frame (eg. the first three nucleotides of each sequence is a codon). The coding region of the gene is 1602 bp and the position of the sequences shown below is…arrow_forwardThe accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)arrow_forwardHuntington disease (HD) can arise from a rare, short, in-frame addition of CAG nucleotide triplets within the huntingtin (HTT) gene coding region, which creates a disease-causing allele with the symptoms only appearing later in life. Using this information, describe an experiment that could be undertaken to determine whether a currently healthy young individual is a carrier of the HD-causing mutation. Describe the method you would use and how you would interpret the results of this experiment.arrow_forward
- What type of mutation is C c?arrow_forwarda. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?arrow_forwardIn the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) 5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Normal Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation Nonsense mutation Frameshift mutations Missense mútationarrow_forward
- Leber congenital amaurosis (LCA) is a form of congenital blindness in humans and is known to be caused by homozygosity for recessive mutations in the RPE65 gene. Recently, a rare dominant mutation in RPE65 has been implicated as one cause of an eye disease called retinitis pigmentosa, which is characterized by retinal degeneration that can progress to blindness. The dominant RPE65 mutation is a missense mutation causing amino acid 447 in the polypeptide to change from Asp to Glu. Little is known about the nature of the mutant protein. a. Do you think that the dominant allele is more likely a loss-of-function or a gain-of-function mutation? Explain. b. Recently a group of clinicians and scientists reported that gene therapy (gene replacement therapy) for LCA has been at least partially successful. Do you think that the same kind of gene therapy can be used for patients with retinitis pigmentosa caused by the dominant mutant allele of RPE65? Explain.arrow_forwardExposure to various chemicals can cause DNA mutations. Classify the examples as representative of transition, transversion, or nsertion/deletion mutations. Transition replacement of T:A: with C:G treatment with nitrogen mustard causes this type of mutation oxidative deamination via nitrous acid causes this type of mutation treatment with 5-bromouracil causes the replacement of A:T with G:C Transversion replacement of G:C with T:A Answer Bank Insertion/Deletion the removal of one or more base pairs treatment with proflavin causes this type of mutationarrow_forwardHuntington’s disease is a hereditary central nervous system disorder characterized by tandem repeats of the sequence 5'-CAG-3' in the gene that encodes a protein called huntingtin. The disease is progressive from generation to generation, meaning that in later generations the number of CAG repeats increases and the age of onset of symptoms decreases. Refer to Figure 21.4 and describe the sort of evidence supporting the generational increase in the number of CAG repeats.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY