Below are 9 possible primer pairs. Determine which primer pair is the best choice by considering the following: 1. primers should be 18-24 bases in length; 2. base composition should be 45-55% (G+C); 3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming; 4. Tms between 55-70°C are preferred (Tas, annealing temperatures, are approximately 5°C lower than the Tm); 5. the Tm for your primer pair should be within 2 degrees of each other, though ideally the same; 6. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided; 7. 3'-ends of primers should not be complementary (i.e. base pair), as otherwise the formation of primer dimers will result; 8. primer self-complementary (ability to form secondary structures such as hairpins) should be avoided. • Explain why the other primers are not good choices. Underline or highlight the region of DNA for the primer pair you chose as the best. Forward 1: Reverse 1: Forward 2: Reverse 2: Forward 3: Reverse 3: Forward 4: Reverse 4: Forward 5: Reverse 5: Forward 6: Reverse 6: Forward 7: Reverse 7: Forward 8: Reverse 8: Forward 9: Reverse 9: Answer: 5' gaaataattttgtttaactttaag 3' 5' gtttaagacaaaatagtctgg 3' 5' gtaactcagetttcaggtcg 3' 5' tctcggaatgttgcaacage 3' 5' agattagcggatcctacctg 3' 5' atgtgtaatcccagcagcag 3' 5' cattgattatttgcacggcg 3' 5' aaaatcttctctcatccgcc 3' 5' tccataagattagcggatcc 3' 5' tgcaagettggctgttttgg 3' 5' gatectacctgacgcttttta 3' 5' aaataatgaattegagetcggt 3' 5'ataaaaaaategagataaccgtt 3' 5'aggtcgactctagaggate 3' 5'ctacctgttccatggccaac 3' 5' ttcgggcatggcactcttg 3' 5' tccataagattagcggatec 3' 5' tctcgcatgggggaccccac 1. Best primer pair choice: 2. Why are the rest not good choices? Tm = 56°C Tm = 56°C Tm= 60°C Tm= 60°C Tm= 60°C Tm = 60°C Tm = 58°C Tm= 58°C Tm = 58°C Tm= 60°C Tm= 60°C Tm = 60°C Tm = 58°C Tm= 58°C Tm= 62°C Tm= 60°C Tm = 58°C Tm = 68°C
Below are 9 possible primer pairs. Determine which primer pair is the best choice by considering the following: 1. primers should be 18-24 bases in length; 2. base composition should be 45-55% (G+C); 3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming; 4. Tms between 55-70°C are preferred (Tas, annealing temperatures, are approximately 5°C lower than the Tm); 5. the Tm for your primer pair should be within 2 degrees of each other, though ideally the same; 6. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided; 7. 3'-ends of primers should not be complementary (i.e. base pair), as otherwise the formation of primer dimers will result; 8. primer self-complementary (ability to form secondary structures such as hairpins) should be avoided. • Explain why the other primers are not good choices. Underline or highlight the region of DNA for the primer pair you chose as the best. Forward 1: Reverse 1: Forward 2: Reverse 2: Forward 3: Reverse 3: Forward 4: Reverse 4: Forward 5: Reverse 5: Forward 6: Reverse 6: Forward 7: Reverse 7: Forward 8: Reverse 8: Forward 9: Reverse 9: Answer: 5' gaaataattttgtttaactttaag 3' 5' gtttaagacaaaatagtctgg 3' 5' gtaactcagetttcaggtcg 3' 5' tctcggaatgttgcaacage 3' 5' agattagcggatcctacctg 3' 5' atgtgtaatcccagcagcag 3' 5' cattgattatttgcacggcg 3' 5' aaaatcttctctcatccgcc 3' 5' tccataagattagcggatcc 3' 5' tgcaagettggctgttttgg 3' 5' gatectacctgacgcttttta 3' 5' aaataatgaattegagetcggt 3' 5'ataaaaaaategagataaccgtt 3' 5'aggtcgactctagaggate 3' 5'ctacctgttccatggccaac 3' 5' ttcgggcatggcactcttg 3' 5' tccataagattagcggatec 3' 5' tctcgcatgggggaccccac 1. Best primer pair choice: 2. Why are the rest not good choices? Tm = 56°C Tm = 56°C Tm= 60°C Tm= 60°C Tm= 60°C Tm = 60°C Tm = 58°C Tm= 58°C Tm = 58°C Tm= 60°C Tm= 60°C Tm = 60°C Tm = 58°C Tm= 58°C Tm= 62°C Tm= 60°C Tm = 58°C Tm = 68°C
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
Related questions
Question
Transcribed Image Text:Below are 9 possible primer pairs.
● Determine which primer pair is the best choice by considering the following:
1. primers should be 18-24 bases in length;
2. base composition should be 45-55% (G+C);
3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and
increases efficiency of priming;
4. Tms tween 55-70°℃ are preferred (Tas, annealing temperatures, are approximately 5°C
lower than the Tm);
5. the Tm for your primer pair should be within 2 degrees of each other, though ideally the
same;
6. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or
C-rich sequences (because of stability of annealing), and should be avoided;
7.
3'-ends of primers should not be complementary (i.e. base pair), as otherwise the formation
of primer dimers will result;
8. primer self-complementary (ability to form secondary structures such as hairpins) should
be avoided.
• Explain why the other primers are not good choices.
● Underline or highlight the region of DNA for the primer pair you chose as the best.
Forward 1:
Reverse 1:
Forward 2:
Reverse 2:
Forward 3:
Reverse 3:
Forward 4:
Reverse 4:
Forward 5:
Reverse 5:
Forward 6:
Reverse 6:
Forward 7:
Reverse 7:
Forward 8:
Reverse 8:
Forward 9:
Reverse 9:
Answer:
5' gaaataattttgtttaactttaag 3'
5' gtttaagacaaaatagtctgg 3'
5' gtaactcagetttcaggtcg 3'
5' tctcggaatgttgcaacage 3'
5' agattageggatcctacctg 3'
5' atgtgtaatcccagcagcag 3'
5' cattgattatttgcacggcg 3'
5' aaaatcttctctcatccgcc 3'
5' tccataagattageggatce 3'
5' tgcaagettggetgttttgg 3'
5' gatcctacctgacgcttttta 3'
5' aaataatgaattegagctcggt 3'
5'ataaaaaaategagataaccgtt 3'
5'aggtcgactctagaggate 3'
5'ctacctgttccatggccaac 3'
5' ttcgggcatggcactcttg 3'
5' tccataagattageggatec 3'
5' tctcgcatgggggaccccac 3'
1. Best primer pair choice:
2. Why are the rest not good choices?
Tm = 56°C
Tm = 56°C
Tm = 60°C
Tm = 60°C
Tm=
60°C
Tm = 60°C
Tm = 58°C
Tm = 58°C
Tm = 58°C
Tm = 60°℃
Tm= 60°C
Tm = 60°C
Tm = 58°C
Tm = 58°C
Tm= 62°C
Tm= 60°C
Tm = 58°C
Tm = 68°C
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by step
Solved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education