Primer pairs of homo sapiens isolate breast cancer brca1 gene.Select the best primer pair then give 5 reasons why is it the best Primer pair 1Forward primerReverse primerProduct lengthPrimer pair 2Forward primerReverse primerProduct lengthPrimer pair 3Forward primerReverse primerProduct lengthPrimer pair 4Forward primerReverse primerProduct lengthPrimer pair 5Forward primerReverse primerProduct lengthPrimer pair 6Forward primerReverse primerProduct lengthSequence (5'->3')ACATGCCCACAGGTAAGAGCGCAATCTGAGGAACCCCCAT111Sequence (5'->3¹)ATGGGGGTTCCTCAGATTGCTGCTCTTGAGAAGGGGGACA131Sequence (5'->3')GGTAAGAGCCTGGGAGAACCAACCCCCATCGTGGGATCTT89Sequence (5'->3')CTTCACCAACATGCCCACAGTTCAGCAATCTGAGGAACCCC123Sequence (5'->3')GGGGGCTAGAAATCTGTTGCTCTGGAACTCTGGGGTTCTCC79Sequence (5'->3')GGGAGAACCCCAGAGTTCCAACCCCCATCGTGGGATCTT77Template strandPlusMinusTemplate strandPlusMinusTemplate strandPlusMinusTemplate strandPlusMinusTemplate strandPlusMinusTemplate strandPlusMinusLength Start Stop Tm2020Length2020Length2020Length2021Length2019GC%250 269 60.04 55.00 4.00360 341 59.74 55.00 3.00Self complementarityStart Stop Tm GC% Self complementarity341 360 59.74 55.00 3.00471 452 60.47 55.00 4.00Start Stop Tm GC%261 280 59.46 60.00349 330 60.92 55.00Start Stop Tm GC%242 261 59.40 55.00364 344 60.00 52.38Self complementarity3.006.00Self complementarity4.005.00Length Start Stop Tm GC%21214 234 60.06 52.38 4.00292 273 59.38 60.00 6.0020Self complementarityStart Stop Tm GC% Self complementarity272 291 60.84 60.00 6.00348 330 60.31 57.89 6.00Self 3' complementarity2.002.00Self 3' complementarity2.000.00Self 3' complementarity0.002.00Self 3' complementarity1.002.00Self 3' complementarity3.002.00Self 3' complementarity2.000.00

Primers are used in PCR techniques which enable us to generate several copies of a desired DNA…

Answered: Primer pairs of homo sapiens isolate…

Primer pairs of homo sapiens isolate breast cancer brca1 gene. Select the best primer pair then give 5 reasons why is it the best

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Based on the NCBI blast below Are there any pathogenic missense mutations in the human gene FGFR3? Also do they have any identical amino acids to prove a mouse is the best model to test the fgfr3 gene?
When doing the virtual DNA microarray analysis, which color (red, green or yellow) would the spot be if that gene was inappropriately inactivated in the cancer cell? When doing the virtual DNA microarray analysis, which color (red, green or yellow) indicated that the cancer cell had an activated a gene that is not normally as active in the non-cancerous version of the cell?
All of the following pieces of information are expected to be obtained directly from Western Blot analysis, except: An estimation of the fusion protein’s size Relative quantity of the fusion protein compared to other samples The amino acid sequence of the fusion protein If the fusion protein is present in the sample
Compare and contrast the advantages and disadvantages of production of genetically modified crps.
Explain the process of how X-gal screening works with pUC19, you may build a model with boxes and arrows. 2. You are utilizing BamHI (GGATCC) restriction site and HindIII (AAGCTT) restriction site. Within pUC19, BamHI is at position 263, while HindIII is at position 233. (Hint: position is like coordinate on a map). If you manage to insert GTF2H5 in pUC19 vector, what are the sizes of fragments if you digest the pUC19-GTF2H5 (this is after insertion) with the following restriction enzyme combination after gel electrophoresis: BamHI and HindIII There is an NdeI site right in the middle of the GTF2H5 that has been inserted in pUC19, what would be the fragment sizes, if you digest with BamHI and NdeI. HindIII and NdeI BamHI, HindIII, and NdeI. 3. Design an experiment to confirm the presence of insert GTF2H5 in pUC19 vector using the following method (besides restriction analysis above), assuming that you know the sequence of GTF2H5: Southern Blot Polymerase Chain Reaction
1) What are the limitations of targeted versus whole-genome or whole-exome profiling of cancer mutations? 2) What can you infer about mutations that are common to almost all of the cells in a tumor? 3) Summarize the high-level differences between the VCF and MAF file formats. 4) How do germline and somatic mutations differ in terms of their effect on cancer risk and prognosis?
In the following "gene library" cloning experiment Digested genomic DNA AmpR gene TCR gene TCR is tetracycline resistant marker, AmpR is ampicillin resistant marker and BamHI is the unique restriction enzyme on plasmid. A PhD student digests/cuts the plasmids with BamHI restriction enzyme and the genomic DNA with EcoRI restriction enzyme. After performing the cloning experiment and obtaining colonies on a selection plate, the obtained cells will be ..... (Hint: this question is even more challenging; the PhD student was later demoted to an MSc student). a) resistant to ampicillin and tetracycline b) sensitive to tetracycline and ampicillin c) resistant to tetracycline and sensitive to ampicillin d) resistant to ampicillin and sensitive to tetracycline e) sensitive to ampicillin and tetracycline BamHI
Include references! How can we analyze the interest protein expression in cultured cells after we transfect with the following vectors including gene of interest: Green fluorescent protein (GFP) including vectors His-tag including vectors
Assume you have successfully cloned a small (200 bp) fragment of DNA into the polylinker region of a pUC18 cloning vector. Describe the appearance of transformed colonies you would expect to see on each of the following plates: plain media, media containing ampicillin, media containing tetracycline, media containing ampicillin and X-Gal.