Concept explainers
To discuss:
Why every generation of cells must synthesize new DNA, although the number of chromosome remains the same from one generation to the next.
Introduction:
Cell cycle is an essential process by which cells increase in number while maintaining its genetic stability. In an organism, it is vital for growth and regeneration. However, it has to be tightly regulated to avoid dire consequences. Twenty-three pairs of chromosomes (total 46) are present in the human DNA. All two pairs of chromosomes carry the same genes except X and Y chromosomes. The X and Y chromosomes are called as the sex chromosomes; they determine the sex of human beings. The remaining 22 pairs of chromosomes are termed as autosomes.
Want to see the full answer?
Check out a sample textbook solutionChapter 4 Solutions
Anatomy & Physiology: The Unity of Form and Function
- Why is it important for chromosomes to be copied before cell divisionsarrow_forwardWhich of the following statements is not true about DNA replication? a. It occurs during the M phase of the cell cycle. b. It makes a sister chromatid. c. It denatures DNA strands. d. It occurs semiconservatively. e. It follows base-pairing rules.arrow_forwardWhat is the function of DNA polymerase? a. It degrades DNA in cells. b. It adds RNA nucleotides to a new strand. c. It coils DNA around histones to form chromosomes. d. It adds DNA nucleotides to a replicating strand. e. None of these.arrow_forward
- How does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.arrow_forwardDNA can copy itself through a process known as _____.arrow_forwardPhases of the cell cycle (Mitosis) Interphase DNA, in the form of chromatin, replicates. Nucleolus is present, but may not be visible. Nucleus is clearly visible.arrow_forward
- Which of these molecules links the most of the individual DNA nucleotides together on the newly synthesized strands of DNA? topoisomerase DNA polymerase ligase RNA primase helicasearrow_forwardIt is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand: GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT It is now time to make a protein. Using the same stand of DNA, transcribe it to mRNA, then translate to an amino acid sequence (use the codon table below).arrow_forwardPolymerase chain reaction mimics the cells ability to: translate mRNA into protein transcribe dna to mrna replicates dna repair dna edit dnaarrow_forward
- DNA structure from least to most condensed. Chromatin Chromatid Nucleosomearrow_forwardArrange the steps of DNA replication in the order that they occur. First step Helicase unwinds the DNA double helix. Last step Answer Bank DNA polymerase synthesizes DNA. RNA primers are added. DNA ligase joins DNA fragments together. RNA primers are removed. Single-stranded DNA-binding proteins bind to each template strand.arrow_forwardhow to extract DNA from everythingarrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning