Concept explainers
Introduction:
DNA is a genetic material, consisting long stretch of
Want to see the full answer?
Check out a sample textbook solutionChapter 4 Solutions
Anatomy & Physiology: The Unity of Form and Function
- Describe the process of initiation, elongation and termination.arrow_forwardHere is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that would be transcribed from the bottom strand of the DNA:arrow_forwardSelect all TRUE statements related to the process of transcription. More than one answer is possible. The enzyme helicase separates the complimentary base pairs that hold double-stranded DNA together. MRNA is formed by joining ribonucleotides that pair with the template strand of DNA MRNA is formed by joining ribonucleotides that pair with the coding strand of DNA exons are removed from MRNA. Okazaki fragments form on the lagging strand. introns are removed from mRNA. The enzyme DNA gyrase encompasses both strands of DNA and uncoils the helix of double-stranded DNA. transcription is the process by which MRNA codons are translated to proteins. MRNA formed will be complimentary to the coding strand. DNA is unwound to expose the targeted genearrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning