Biological Science
5th Edition
ISBN: 9780321743671
Author: Scott Freeman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 4, Problem 13TYPSS
Make a concept map (see BioSkills 12 ) that relates DNA's primary structure to its secondary structure. Your diagram should include deoxyribonucleotides, hydrophobic interactions, purines, pyrimidines, phosphodiester linkages, DNA primary structure, DNA secondary structure, complementary base pairing, and antiparallel strands.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What are the complementary base pairs in DNA-RNA interactions? Answer format: Base 1(one letter symbol)-Base 2 (one letter symbol, or B-B*(hypothetical N-base)
In the lengthening of a polynucleotide chain, which type of nucleotide subunit (name please not the formula) would bond to its 3’ end?
How many 3’,5’-phosphodiester linkages are present in a tetranucleotide segment of a nucleic acid?
To create a DNA:RNA hybrid from a short stretch of DNA with the sequence
5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA
sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B
or Z) will this double-stranded nucleic acid form?
Consider normal B-form DNA. It forms a regular antiparallel double-helical structure with
Watson-Crick base-pairing mediated through hydrogen bonding. The base pairs all stack
upon one another, with 3.4 Å spacing between them. DNA strands having a complementary
sequence will spontaneously form a double-helix in an aqueous solution.
In terms of energy, what primarily drives helix formation?
O Positive Entropy from base stacking
van der Waals interactions
O Hoogsteen interactions
Positive Enthalpy from Hydrogen Bonding between GC and AT pairs
Negative Enthalpy from Hydrogen Bonding between GC and AT pairs
O Negative Entropy from base stacking
Chapter 4 Solutions
Biological Science
Ch. 4 - What are the four nitrogenous bases found in RNA?...Ch. 4 - 2. What determines the primary structure of a DNA...Ch. 4 -
4. Which of the following rules apply to the...Ch. 4 - Prob. 3TYKCh. 4 - Prob. 5TYKCh. 4 -
6. What is responsible for the increased...Ch. 4 - Prob. 8TYUCh. 4 - Prob. 9TYUCh. 4 - Prob. 7TYUCh. 4 - Prob. 10TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixarrow_forwardAs a result of the rotation about its six bonds, DNA can exist in a variety of forms. Determine whether the image and properties describe the A form of DNA, the B form of DNA, the Z form of DNA, or all three. A form G pairs with C, and A pairs with T. antiparallel strands A HOCH₂ OH most stable under physiological conditions B form Answer Bank has a 23.7 Å helix diameter widest helix diameter Z form left-handed narrowest helix diameter the favored form of dehydrated DNA All The C2' of deoxyribose is out of the plane of the other ring atoms in the direction of 05'.arrow_forwardDraw a DNA structure that includes at least two criss crosses There must be 5 nucleotide pairs above and below each intersect. Label §Adenine §Thymine §Guanine §Cytosine §Phosphates §Sugars §Hydrogen bonds Color code each part and provide a keyarrow_forward
- Select the phrases that accurately describe properties of the most common form of the DNA double helix. DNA contains equal amounts of adenine and thymine and equal amounts of cytosine and guanine. The nitrogenous bases are exposed to the solvent, whereas the sugar-phosphate backbone of each nucleotide strand is in the interior of the double helix. The phosphodiester bonds between nucleotide residues run in opposite directions in the two strands. Base pairs have a spacing of 3.4 Å. A helical turn consists of about 3.4 base pairs.arrow_forwardConsider the following image - the dotted lines represent hydrogen bonds between nitrogenous bases: (T) Thymine (A) Adenine (A) Adenine (U) Uracil (C) Cytosine (G) Guanine (C) Cytosinel (G) Guanine Which of the following does this image likely represent? OA section of an enzyme bound to a DNA strand A section of a double stranded DNA A section of RNA primer bound to a DNA strand Two sections of an RNA strands bound togetherarrow_forwardWhen comparing the structures of RNA and DNA , which of the following statement is True?A-Only RNA contains 3'-deoxyribise rings B-Both RNA and DNA contain 3'-deoxyribise rings C-Only DNA contains 3'- deoxyribise rings D-Neither RNA or DNA contain 3'-deoxyribise ringsarrow_forward
- The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?arrow_forward10.) Draw a double-stranded DNA molecule (using different colors for each) model should clearly represent the sequence: A G T A C C G G G C A A Note: It should include items to represent - sugar molecules - phosphate molecules - 4 distinct nitrogenous base molecules (Adenine, Thymine, Cytosine, and Guanine) - two types of bonds between these moleculesarrow_forwardBased on your understanding of DNA structure thus far, design a synthetic nucleotide that can be integrated into a DNA molecule AND be functional. Take the following into consideration: DNA Nano measurements: width of the helix, spacing between nucleotides Use the functional groups that you’ve learned about Remember that hydrogen bonding stabilizes the DNA moleculearrow_forward
- Spot the difference between the chemical structures of DNA & RNA and state the said difference in a short paragraph. Please refer in the attached picture for the answer.arrow_forwardGiven the structures of the nitrogenous bases below, draw the structure of a part of DNA with the sequence: 5'-GTTCA-3'.arrow_forwardThe sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY