Concept explainers
(a)
Interpretation:
The complementary sequence of bases for each given DNA strand has to be written.
Concept Introduction:
Composition of
Base pairing in DNA: The two strands of the DNA double helix run in the opposite directions- one in 5’ to 3’ direction and other from 3’ to 5’ direction. The hydrogen bonding between two strands enhances the stability of the DNA; where the alignment of hydrophobic nitrogenous bases in the interior and hydrophilic phosphate and sugar groups on the exterior also enhance the stability. Adenine and thymine gives a pair forming two hydrogen bonds and cytosine and guanine gives rise to another pair forming three hydrogen bonds.
Sugar: In both DNA and RNA, sugar portion is found. In DNA, the sugar is D-ribose, where at 2’hydroxyl group is absent and in RNA, the hydroxyl group is present at 2’.
Nitrogenous bases: Five types of nitrogenous bases (has unique one-letter code A, G, T, U, and C) are derived from two parent compounds called purine and pyrimidine. The purine derivatives are Adenine and Guanine are two fused nitrogen containing rings. The pyrimidine derivatives are Thymine, Cytosine, and Uracil are only one nitrogen containing six-membered ring. Adenine, Guanine, Thymine, and Cytosine are the nitrogenous bases present in DNA. Adenine, Guanine, Cytosine and Uracil are the nitrogenous bases present in RNA.
(b)
Interpretation:
The complementary sequence of bases for each given DNA strand has to be written.
Concept Introduction:
Composition of nucleic acid: Nucleic acid is a polymer of nucleotides. Each nucleotide has three parts: a sugar, a nitrogenous base, and a phosphate group. Two nucleotides are joined by phosphate diester linkage where a free phosphate on 5’ carbon of one nucleotide and a free –OH group on 3’ carbon of another nucleotide.
Base pairing in DNA: The two strands of the DNA double helix run in the opposite directions- one in 5’ to 3’ direction and other from 3’ to 5’ direction. The hydrogen bonding between two strands enhances the stability of the DNA; where the alignment of hydrophobic nitrogenous bases in the interior and hydrophilic phosphate and sugar groups on the exterior also enhance the stability. Adenine and thymine gives a pair forming two hydrogen bonds and cytosine and guanine gives rise to another pair forming three hydrogen bonds.
Sugar: In both DNA and RNA, sugar portion is found. In DNA, the sugar is D-ribose, where at 2’hydroxyl group is absent and in RNA, the hydroxyl group is present at 2’.
Nitrogenous bases: Five types of nitrogenous bases (has unique one-letter code A, G, T, U, and C) are derived from two parent compounds called purine and pyrimidine. The purine derivatives are Adenine and Guanine are two fused nitrogen containing rings. The pyrimidine derivatives are Thymine, Cytosine, and Uracil are only one nitrogen containing six-membered ring. Adenine, Guanine, Thymine, and Cytosine are the nitrogenous bases present in DNA. Adenine, Guanine, Cytosine and Uracil are the nitrogenous bases present in RNA.
Want to see the full answer?
Check out a sample textbook solutionChapter 26 Solutions
Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
- How many kilobases of the DNA strand below will code for the protein product?arrow_forwardFor the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandarrow_forwardIf the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?arrow_forward
- Consider the following DNA sequence: -T -- -- If RNA primase used this section of DNA to make a primer, what would be the correct sequence of base pairs (from top to bottom)? T-A-C-C-G-T-T OT-U-C-C-G-U-U OA-T-G-G-C-A-A U-A-C-C-G-U-Uarrow_forwardThe composition (in molefraction units) of one of the strands of a double-helical DNA molecule is [A] = 0.30 and [G] =0.24. (a) What can you say about [T] and [C] for the same strand? (b) What can you say about [A], [G], [T], and [C] of the complementary strand?arrow_forwardDraw the full structure of the DNA dinucleotide C-T. Identify the 5′ and 3′ ends of this dinucleotide.arrow_forward
- (a) Write the DNA double strand. (b) Assuming the gel pattern represents the template strand, transcribe and translate the DNA. (c) Write the anticodon sequence. A G 2nd (middle) Base of a Codon 1* 3rd U A G Base Base UUU - Phe U UUC - Phe UCU - Ser UCC - Ser UAU - Tyr UAC - Tyr UGU - Cys UGC - Cys UUA - Leu UCA- Ser UAA - STOP UGA - STOP UUG -Leu CUU - Leu CUC - Leu UCG-Ser CCU - Pro CCC- Pro UAG- STOP CAU - His САC - His UGG- Trp CGU - Arg CGC - Arg CGA - Arg CGG- Arg CỦA - Leu ССА-Pro CAA - Gin CAG- Gin AAU - Asn CUG - Leu CCG-Pro AUU - Ile ACU - Thr АCC - Th ACA - Thr AGU – Ser A AGC - Ser AGA - Arg AGG - Arg GGU - Gly GGC - Gly GGA - Gly GGG - Gly AUC - lle AAC - Asn AAA - Lys AAG - Lys GAU - Asp GAC - Asp GAA - Glu AUA- lle AUG - Met ACG - Thr G GUU - Val GCU - Ala GCC - Ala GUC - Val GUA- Val GCA - Ala GUG - Val GCG - Ala GAG - Glu PUAGPCAGUCACUCAG |arrow_forwardList the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-Garrow_forwardThe A and G compositions (mole percent) of one of the strands of a duplex DNA is A = 27 and G = 30. (a) What would be the T and C compositions of the complementary strand? (b) What can be said about the A and G compositions of its complementary strand?arrow_forward
- A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the complementary base sequence for the matching strand in the DNA section shown below.5’ – C T G T A T A C G T T A – 3’ Please answer both partsarrow_forwardGiven the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?arrow_forwardA circular, double-stranded DNA contains 2100 base pairs. The solution conditions are such that DNA has 10.5 bp/turn. (a) What is Lo for this DNA? (b) The DNA is found to have 12 left-handed superhelical turns. What is the superhelix density o?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning