Concept explainers
Interpretation:
The three different base triplets that could be combined to code for the given amino acids Leu-Leu-Leu has to be predicted.
Concept Introduction:
Codon: A sequence of three ribonucleotides in the mRNA chain that codes for a specific amino acid; also a three-
Genetic code: The sequence of nucleotides, coded in triplets (codons) in mRNA that determines the sequence of amino acids in protein synthesis.
Illustrated relationships are:
DNA informational strand: 5’ ATG CCA GTA GGC CAC TTG TCA 3’
DNA Template strand: 3’ TAC GGT CAT CCG GTG AAC AGT 5’
mRNA: 5’ AUG CCA GUA GGC CAC UUG UCA 3’
protein: Met Pro Val Gly His Leu Ser
Notice: 5’ end of the mRNA strand codes for the N-terminal amino acid, whereas the 3’ end of the mRNA strand codes for the C-terminal amino acid. Proteins are always written N-terminal to C-terminal, reading left to right.
Want to see the full answer?
Check out a sample textbook solutionChapter 26 Solutions
Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
- A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.arrow_forwardPolypeptides can be translated in vitro. Would a bacterial mRNA be translated in vitro by eukaryotic ribosomes? Would a eukaryotic mRNA be translated in vitro by bacterial ribosomes? Why or why not?arrow_forwardDraw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can result from alternative splicing of this RNA.arrow_forward
- Another thalassemic patient had a mutation leading to the production of an mRNA for the β chain of hemoglobin that was 900 nucleotides longer than the normal one. The poly(A) tail of this mutant mRNA was located a few nucleotides after the only AAUAAA sequence in the additional sequence. Propose a mutation that would lead to the production of this altered mRNA.arrow_forwardConsider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this mRNA? (b) What dipeptide is formed if a mutation converts CUG to CUU? (c) What dipeptide is formed if a mutation converts CAC to CGC? (d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?arrow_forwardConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forward
- Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the one-letter abbreviation of the protein product of the mRNA transcript?arrow_forwardIn eukaryotes there is not a consistent relationship between the length of the coding sequence of a gene and the length of the mature mRNA it encodes, even though one nucleotide in DNA = one nucleotide in pre-mRNA or primary transcript. Explain why this is so.arrow_forwardConsider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part 1 of 5 What amino acid sequence is coded for by this mRNA? Leu-Thr-Asp Part 2 of 5 What is the amino acid sequence if a mutation converts UUG to UUA? Leu-Thr-Asp Part 3 of 5 What is the amino acid sequence if a mutation converts ACC to AGC? Leu-Ser-Asp Part: 3/5 Part 4 of 5 What is the amino acid sequence if a mutation converts GAC to CACTarrow_forward
- Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part 1 of 5 What amino acid sequence is coded for by this mRNA? Leu-Thr-Asp Part 2 of 5 What is the amino acid sequence if a mutation converts UUG to UUA? Leu-Thr-Asp Part 3 of 5 What is the amino acid sequence if a mutation converts ACC to AGC? Leu-Ser-Asp Part 4 of 5 What is the amino acid sequence if a mutation converts GAC to CACT Leu-Thr-His Part: 4/5 Part 5 of 5 What is the amino acid sequence if G is added to the beginning of the chain? x Sarrow_forwardUsing the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAUarrow_forwardif a protein that contain the two codon sequences showed a molar mass of 97,313 g /mol and the UV data showed that it contains 0.67 % Tyrosine amino acid by weight. How many Tyrosine amino acids this protein contain? If this protein that was formed contains a total of 865 amino acids long, how many nucleic acids are there in the mRNA including the initiator and the terminator codons?arrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON