Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
8th Edition
ISBN: 9780134015187
Author: John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 26.8, Problem 26.15P

a)

Interpretation Introduction

Interpretation:

The mRNA strand from the given DNA template strand has to be predicted.

Concept Introduction:

RNA synthesis: The process of RNA synthesis is Transcription. A small section of DNA unwinds, only one of the two strands act as template and the other strand as informational strand. The complementary bases are attached one by one by the action of RNA polymerase at template strand on moving down. The newly generated RNA is the exact copy of the informational strand, with the exception that a U replaces each T in the template DNA. The RNA synthesised carries genetic information and directs protein synthesis.

Illustrated relationships are:

DNA informational strand: 5’ ATG CCA GTA GGC CAC TTG TCA 3’

DNA Template strand: 3’ TAC GGT CAT CCG GTG AAC AGT 5’

mRNA: 5’ AUG CCA GUA GGC CAC UUG UCA 3’

b)

Interpretation Introduction

Interpretation:

The mRNA strand from the given DNA template strand has to be predicted.

Concept Introduction:

RNA synthesis: The process of RNA synthesis is Transcription. A small section of DNA unwinds, only one of the two strands act as template and the other strand as informational strand. The complementary bases are attached one by one by the action of RNA polymerase at template strand on moving down. The newly generated RNA is the exact copy of the informational strand, with the exception that a U replaces each T in the template DNA. The RNA synthesised carries genetic information and directs protein synthesis.

Illustrated relationships are:

DNA informational strand: 5’ ATG CCA GTA GGC CAC TTG TCA 3’

DNA Template strand: 3’ TAC GGT CAT CCG GTG AAC AGT 5’

mRNA: 5’ AUG CCA GUA GGC CAC UUG UCA 3’

Blurred answer
Students have asked these similar questions
What mRNA base sequences are complementary to the following DNA template sequences? Be sure to label the 5′ and 3′ ends of the complementary sequences.(a) 5′CAT GCT CTA CAG 3′ (b) 3′TAT TAG CGA CCG 5′
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B )  Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid.  Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid

Chapter 26 Solutions

Fundamentals of General, Organic, and Biological Chemistry (8th Edition)

Ch. 26.4 - Prob. 26.11KCPCh. 26.6 - What are Okazaki fragments? What role do they...Ch. 26.6 - Prob. 26.13PCh. 26.8 - Prob. 26.14PCh. 26.8 - Prob. 26.15PCh. 26.9 - Prob. 26.1CIAPCh. 26.9 - Prob. 26.2CIAPCh. 26.9 - Using a variety of sources, research which...Ch. 26.9 - Prob. 26.4CIAPCh. 26.9 - List possible codon sequences for the following...Ch. 26.9 - Prob. 26.17PCh. 26.9 - What amino acids do the following sequences code...Ch. 26.9 - Prob. 26.19PCh. 26.10 - Prob. 26.20PCh. 26.10 - What anticodon sequences of tRNAs match the mRNA...Ch. 26 - Combine the following structures to create a...Ch. 26 - Prob. 26.23UKCCh. 26 - Copy the following simplified drawing of a DNA...Ch. 26 - Prob. 26.25UKCCh. 26 - Prob. 26.26UKCCh. 26 - Prob. 26.27APCh. 26 - Prob. 26.28APCh. 26 - Prob. 26.29APCh. 26 - Prob. 26.30APCh. 26 - Prob. 26.31APCh. 26 - For the following molecule: (a) Label the three...Ch. 26 - Prob. 26.33APCh. 26 - Prob. 26.34APCh. 26 - Prob. 26.35APCh. 26 - Prob. 26.36APCh. 26 - Draw structures to show how the sugar and...Ch. 26 - What is the difference between the 3 end and the 5...Ch. 26 - Prob. 26.39APCh. 26 - Prob. 26.40APCh. 26 - Draw the complete structure of the RNA...Ch. 26 - Prob. 26.42APCh. 26 - Prob. 26.43APCh. 26 - Prob. 26.44APCh. 26 - Prob. 26.45APCh. 26 - If a double-stranded DNA molecule is 22% G, what...Ch. 26 - How are replication, transcription, and...Ch. 26 - Why is more than one replication fork needed when...Ch. 26 - Prob. 26.49APCh. 26 - What are the three main kinds of RNA, and what are...Ch. 26 - Prob. 26.51APCh. 26 - Prob. 26.52APCh. 26 - Prob. 26.53APCh. 26 - Prob. 26.54APCh. 26 - What is a codon and on what kind of nucleic acid...Ch. 26 - Prob. 26.56APCh. 26 - Prob. 26.57APCh. 26 - Prob. 26.58APCh. 26 - What amino acids are specified by the following...Ch. 26 - Prob. 26.60APCh. 26 - What anticodon sequences are complementary to the...Ch. 26 - Prob. 26.62APCh. 26 - Refer to Problem 26.62. What sequence appears on...Ch. 26 - Refer to Problems 26.62 and 26.63. What dipeptide...Ch. 26 - Prob. 26.65APCh. 26 - Prob. 26.66APCh. 26 - Prob. 26.67APCh. 26 - Prob. 26.68APCh. 26 - Prob. 26.69APCh. 26 - Prob. 26.70CPCh. 26 - Prob. 26.71CPCh. 26 - Prob. 26.73CPCh. 26 - Prob. 26.75GPCh. 26 - Prob. 26.76GPCh. 26 - Prob. 26.77GPCh. 26 - Prob. 26.78GP
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY