Concept explainers
Interpretation:
For the synthesis of metenkephalin, the mRNA sequence has to be synthesized.
Concept Introduction:
Codon: A sequence of three ribonucleotides in the mRNA chain that codes for a specific amino acid; also a three-
Genetic code: The sequence of nucleotides, coded in triplets (codons) in mRNA that determines the sequence of amino acids in protein synthesis.
Illustrated relationships are:
DNA informational strand: 5’ ATG CCA GTA GGC CAC TTG TCA 3’
DNA Template strand: 3’ TAC GGT CAT CCG GTG AAC AGT 5’
mRNA: 5’ AUG CCA GUA GGC CAC UUG UCA 3’
protein: Met Pro Val Gly His Leu Ser
Notice: 5’ end of the mRNA strand codes for the N-terminal amino acid, whereas the 3’ end of the mRNA strand codes for the C-terminal amino acid. Proteins are always written N-terminal to C-terminal, reading left to right.
Want to see the full answer?
Check out a sample textbook solutionChapter 26 Solutions
Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
- Choose a pentapeptied composed of five different amino acids. List the five amino acids. Present the messenger RNA codons for the amino acids and the sequence of the nucleotids on the DNA that was originally coded for the pentapeptide.arrow_forwardA normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?arrow_forwardThe following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.arrow_forward
- Met-enkephalin (Tyr–Gly–Gly–Phe–Met) is a painkiller and sedative (Section 21.5). What is a possible nucleotide sequence in the template strand of the gene that codes for met-enkephalin, assuming that every base of the gene is transcribed and then translated?arrow_forwardThe codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine Threoninearrow_forwardConsider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forward
- Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphatearrow_forwardThere is another melanocyte-stimulating hormone called β-melanotropin.Cleavage of β-melanotropin with trypsin produces the following peptidesplus free aspartic acid. WGSPPK DSGPYK MEHFRIf you assume maximum sequence similarity between α-melanotropin andβ-melanotropin, then what must the sequence of the latter be?arrow_forwardLactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids in length. By convention, the amino acids within a polypeptide are numbered from the aminoterminus to the carboxyl-terminus. Are the following questions about lactose permease true or false? A. Because the 64th amino acid is glycine and the 68th amino acid is aspartic acid, the codon for glycine, 64, is closer to the 3′ end of the mRNA than the codon for aspartic acid, 68. B. The mRNA that encodes lactose permease must be greater than 1241 nucleotides in length.arrow_forward
- Shown in the following table are several amino acid substitutionsin the a and b chains of human hemoglobin. determine how many of them can occur as a result of a single nucleotide change.arrow_forwardA heptapeptide when treated with trypsin produced two peptides. T1 (D, G, Y) and T2 (K, F, V, A). When the heptapeptide was treated with chymotrypsin, three peptides were produced: CT1 (K,,Y, G), CT2 (F,A, V), and CT3 (D). The sequences of these peptides is not known, however. When the peptide was treated with Sanger’s Reagent and hydrolyzed, DNP-K and DNP-A were recovered. What is the amino acid sequence of the heptapeptide?arrow_forwardCan you give further explanations regarding this topic? We are about to tackle this in our next lesson and our teacher assigned us to answer this for practice. But I do not have any idea on how to do this.arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning