Q: 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid…
A: The genetic code is a set of rules used by living cells to translate information encoded in genetic…
Q: Refer to the Table of the Genetic Code and match the type of mutation to the following codon changes
A: Mutation : A mutation is defined as the changes in the nucleotide sequence. These results in…
Q: Which of the following mutations would be more detrimental to an organism? 1) a mutation that…
A: Mutations are the alterations in the DNA that can happen either due to internal factors like…
Q: 1. Transcribe and translate the mutated DNA sequences, CIRCLE the mutation, and classify each type…
A: The change in the sequence of the genetic material of an organism that results in any heritable…
Q: You suspect a protein that is being expressed has been affected by a mutation. When you examine the…
A: mutations in the DNA sequences is of many type and can effect the sequence of transcribed mRNA and…
Q: Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and…
A: The Central Dogma theory states that DNA makes RNA and RNA makes protein. DNA undergoes Replication…
Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…
A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…
Q: You have been given the DNA sequence for a particular fragment of DNA. You then isolated the mRNA…
A: Polymerase chain reaction is an artificial process that produces copies of a fragment of DNA and…
Q: Which of the following does NOT happen during translation initiation? The mRNA binds to the small…
A: Translation: It is provess via which the protein is synthesized by the ribosomes after tye process…
Q: The following double stranded segment of DNA is part of a protein coding gene. The segments in…
A:
Q: Cystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR.…
A: Cystic fibrosis is a genetic disease that is characterized by the production of excessively thick…
Q: A reversion is a mutation that returns a mutant codon back to acodon that gives a wild-type…
A: A mutation is a change in the DNA sequence, either due to mistakes during DNA replication or because…
Q: 1 5'- TATATACTGT ATGGTGGGTT GATCTATGTA TCAACAGTAC GGCTCGCAGG TACCCGATGA GATGGGAAGG TGGGTTGACA…
A: Introduction : The genetic code is a system of rules that living cells use to interpret the…
Q: A mutation in the Duchenne muscular dystrophy gene involves the deletion of two bases and their…
A: Boys are mostly affected by the Duchenne muscular dystrophy (DMD). It's an X-linked recessive…
Q: If the DNA sequence that coded for a codon that was complimentary to the ANTICODON AAU underwent a…
A: A mutation may be a change within the sequence of DNA. Mutations can occur as a result of the term…
Q: A gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand…
A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…
Q: Which of the following best describes why it is possible for the bacteria to read the instructions…
A: The instructions to form a protein is inherent in the template strand of DNA. This template strand…
Q: You are working in a research lab that is surveying the CFTR gene sequence in humans to identify new…
A: A synonymous mutation is mutation in the DNA sequence that leads to change in the codon for amino…
Q: Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C.…
A: Hello, thank you for your question, since you have not mentioned the DNA orientation I am answering…
Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…
A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…
Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…
A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…
Q: if the following DNA sequence were transcribed, which of the following describes the output of this…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the…
A: DNA is the genetic material present in our body and RNA encodes for protein molecules. DNA and RNA…
Q: The following DNA sequence corresponds to the two extreme ends of a gene's coding region: 5'…
A: Introduction = The genetic code consists of tripletsThe group of three nucleotides that together…
Q: Which of the following statements about a transversion mutation in the sequence AGC is true?
A: Transversion alludes to a point mutation in DNA in which a solitary (two rings) purine is changed…
Q: Once transcribed, the length of the mRNA for gene X is usually 1000 nucleotides long in your…
A: Rho utilization site , also known by the acronym rut is a sequence of RNA in bacteria upstream of…
Q: The exons and introns of a gene are shown below. Introns are shown as black bars. Exons are numbered…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: (a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in…
A: The biological process by which the information encoded inside a DNA (deoxyribonucleic acid)…
Q: 1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right…
A: Three parts are solved in case of interlinked question as per our company policy. If you want…
Q: The following fictitious double-stranded bacterial DNA sequence codes for a fictitious prot Both…
A: As per the guidelines, this is a question with multi-subparts, we will solve the first three…
Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…
A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…
Q: ) Below are some events that occur in the process of translating mRNA into a protein in a bacterial…
A: The translation is the process of creating protein from RNA. Hereditary information is encoded in…
Q: Look at the MRNA strand below. There are at least a few bases before the "AUG" or the start codon.…
A: Several codons or triplet bases make up the universal genetic code. Over time, the standard code has…
Q: Which type of point mutation does not affect the resulting protein? a deletion b missense mutation…
A: A mutation is any alteration or change in the sequence of the genetic material (DNA or RNA). A point…
Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…
A: Protein consists of amino acids linked by amide bonds or peptide bonds.
Q: The following sequence of DNA is part of the normal, wild-type gene. 5'TAC CGG GAC TTG AGC CGA…
A: A single nucleotide from the DNA is deleted in nucleotide deletion. Although the single nucleotide…
Q: result
A: Transition mutation is nothing but the replacement of one purine nucleotide with other and one…
Q: Which of the following mutations would likely have the greatest negative impact on the protein…
A: Frameshift mutations are basically known as the most injurious changes to the coding succession of a…
Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An…
A:
Q: Which of the following mutations would be most likely to have the most negative effect on the…
A: Translation is the process of synthesis of protein in the cytoplasm.
Q: A DNA
A: DNA acts as the genetic material in most of the organisms . DNA stands for the deoxyribonucleic…
Which of the following mutations in a gene will most likely have the greatest impact on the resulting protein?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following mutations would be most likely to have the most negative effect on the functioning of a protein produced by the gene? Group of answer choices a deletion of one nucleotide at the beginning of the coding sequence a substitution of one nucleotide at the beginning of the coding sequence an insertion of three nucleotides near the end of the coding sequence a substitution of one nucleotide near the end of the coding sequenceA codon is a triplet of bases which codes for an amino acid. Exons are intervening sequence that are not spliced out during transcriptiona modification. RNA can never be double-stranded like DNA in both prokaryotes and eukaryotes. Alteration in BRCA-2 results to breast and ovarian cancer because of defect in the repair by homologous recombination. Write T if the statement is true and write F if the statement is falseOriginal DNA Sequence: TACAC CTTGG CGACGACT... MRNA Sequence: Amino Acid Sequence: Mutated DNA Sequence #5 TACACCTT G G GACGACT... (Highlight the change) What's the mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? 1. Which type of mutation is responsible for new variations of a trait? 2. Which type of mutation does not result in an abnormal amino acid sequence? 3. Which type of mutation stops the translation of an mRNA molecule? NO
- Most nonsense mutations in a structural gene (coding for a protein) have a null phenotype. How many different single base substitution mutations in a protein coding sequence can produce a nonsense mutation? 7 Fr ♥ T: - - A - BIE E % $2. A reversion is a mutation that returns a mutant codon back to a codon that gives a wild-type phenotype. At the DNA level, this type of mutation can be an exact reversion or an equivalent reversion. GAG First GTG Exact GAG (glutamic acid) mutation (valine) reversion (glutamic acid) GAG - GTG First Equivalent (valine) reversion GAA (glutamic acid) mutation (glutamic acid) GAG First GTG Equivalent - GAT (glutamic acid) mutation (valine) reversion (aspartic acid) An equivalent reversion produces a protein that is equivalent to the wild type in structure and function. This can occur in two ways. In some cases, the reversion produces the wild-type amino acid (in this case, glutamic acid), but it uses a different codon than the wild-type gene. Alternatively. an equivalent reversion may substitute an amino acid structurally similar to the wild-type amino acid. In our example, an equivalent reversion has changed valine to an aspartic acid. Because aspartic and glutamic acids are structurally…Which of the following mutations would likely have the greatest negative impact on the protein product of a gene? Group of answer choices a single base deletion close to the end of the coding region of a gene a single base insertion just after the start of the coding region of the gene a deletion of three bases near the middle of the gene a base-pair substitution
- 1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). Please EXCLUDE the use of CRISPR from consideration. A. Will you use germline or somatic cell gene therapy? Please NAME and DEFINE the form of gene therapy selected, then explain WHY this is the most appropriate choice.1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). a) Hypothetically, what specific type of VECTOR will you use to perform your gene therapy? Please select from the following list of potential vectors: disabled retrovirus, adenovirus, adeno-associated virus (AAV), or herpes simplex virus (HSV), then give two reasons why this specific vector is the most appropriate for your gene therapy. Please explain why you were able to rule out the other potential…1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). Other scientists have suggested that it might be possible to use CRISPR to treat this genetic disorder in affected individuals. (i) First, what is CRISPR? (BRIEFLY describe what it is and how it works). (ii) Briefly describe how CRISPR could be utilized in treating genetic conditions such as Batten disease.
- If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?Cystic fibrosis is a life-threatening disease that causes thick, sticky mucus to build up in areas of the body, including the lungs. Scientists are studying CFTR, the gene associated with cystic fibrosis in humans. In the majority of cystic fibrosis patients, the same mutation is seen in the same location on the CFTR geně. A partial DNA sequence, a partial MRNA transcript, and part of the normal polypetide that the makes up the CFTR protein that the CFTR gene codes for are shown in the diagram below. DNA 3 MRNA 5 AUC Polypeptide A partial DNA sequence, a partial MRNA transcript, and part of the CFTR polypeptide in a cystic fibrosis patient are shown in the diagram below. DNA 3 CACAA MRNA 5 Polypeptide Gly A Describe the change in the DNA sequence, the effect on the MRNA, and the effect on the polypeptide. B. Is this a "true" frameshift mutation? Why or why not? C. Would a single base insertion at the beginning of the gene have a larger or smaller effect on the resulting polypeptide…Which of the following statements about a transition mutation in the sequence CGG is true? sequenceIt could result in a single base substitution to give the new codon CCG. It could result in a single base substitution to give the new sequence AGG. It could result in a single base substitution to give the new sequence TGG. A transition mutation in the sequence CGG would always be silent. It could result in a single base substitution to give the new sequence GGG.