The sequence of the lac promoter and two mutant promoters (Mutn 1 and Mutn 2) are shown below. The activity of these promoters is measured by fusing the them to the gene for Green Fluorescent Protein (GFP) and measuring the production of green fluorescence by GFP protein. What would you expect the GFP signal to be higher, lower or same for mutant promoters. Mutn 1 (enter higher, lower or same) Mutn 2 (enter higher, lower or same) -42 ? ? +1 Lac CCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA CCAGGCTTAAAACTTTATGCTTCCGGCTCGTATGTTGTGTGGA Lac Mut1 Lac Mut 2 CCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGA

Q: When researchers analyzed the gad operon they found the following: Expression of the gad operon at…

A: Here we saw that mutant 1 is causing the expression of gad protein even at pH7 which was not…

Q: Describe the difference between a transcriptional fusion and a translational reporter gene fusion.…

A: Transcription fusion means cloning the promoter of interest, upstream of any transcription unit,…

Q: Tỏ idéntify transcriptional regulatory elements, reporters containing 100 base pairs of Promoter…

A: Reporter genes help us to understand and determine the expression of gene of interest by fusing them…

Q: This image shows the alignment of the promoter from the same gene (gene H) across multiple mammalian…

A: Introduction  The central promoter region of genes in archaea and eukaryotes contain a DNA sequence…

Q: complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with…

A: PPE stands for a promoter-proximal element which is an additional promoter that contains AT-rich…

Q: Genes in both prokaryotes and eukaryotes are regulated by activators and repressors.a. Compare and…

A: Gene regulation refers to the mechanisms that are responsible for the repression or induction of…

Q: The lac repressor and the pur repressor are homologous proteins with very similar three-dimensional…

A: The lac represser supermolecule, LacI, prevents the transcription of genes concerned in lactose…

Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…

A: The mutation is the change in the nucleotide sequence of the DNA. The point mutation is the mutation…

Q: Discuss how the expression of a protein can be regulated post transcription in eukaryotic cells…

A: The eukaryotic cell after transcription called the primary transcript is not considered as messenger…

Q: The only way that information is extracted out of DNA is through the transcription of MRNAS that…

A: According to our guideline we can answer only the first question. So upload the second question…

Q: Chromatin Immunoprecipitation (ChIP) experiments enable researchers to measure the levels of…

A: LPS (lipopolysaccharide) treatment results in the recruitment of the transcription factor NfkB and…

Q: In prokaryotes, the promoter contains a -35 and -10 region upstream of the transcription start site.…

A: Promoter is the sequence in DNA where RNA polymerase is recruited. This is present before the…

Q: Name the lambda promoters whose expression is regulated by the cro protein. For each promoter you…

A: CI represses cro and Cro represses cI. This is referred to as the double-negative feedback loop and…

Q: A researchist has found that 1 human promoter is responsible for producing 2various proteins…

A: The information carried by our genome in the form of DNA goes through a number of processes before…

Q: one promoter can regulate the expression of different polypeptides (proteins) in both prokaryotes…

A: Promoter sequences are DNA sequences that define where transcription of a gene by RNA polymerase…

Q: Wild-type E. coli grow best at 37oC, but can grow efficiently at temperatures up to 42oC. An E. coli…

A: Mutations is the phenomenon in which small changes in the nucleotide sequences takes place which…

Q: Concentration (%) A researcher is studying environmental conditions that cause the expression of…

A: We analyze the correlation between pH values and active repressor concentration to identify the…

Q: A which is involved in the silencing of the y-globin gene, is rendered inactive. CL11A is a Land a…

A: Gene silencing is a negative feedback process that controls gene expression and metabolism…

Q: A. A mutation is recovered in the gene that encodes the lactose operon repressor protein (LacI).…

A: Lac operon is a simple prokaryotic group of genes for the metabolism of lactose. It consists of…

Q: control medium that demonstrates the general growth rate of mutant candidates

A: Control Medium: This medium is used to demonstrate the general growth rate of mutant candidates in…

Q: Which of the following is/are true regarding transcription initiation in bacteria? I. TFIID will…

A: To start transcribing a gene, RNA polymerase binds to the promoter region of the gene's DNA.... The…

Q: 1) The UR operon which is composed of sequences A, B, C, and D (which may or may not be genes of…

A: An operon may be considered as a group of certain genes which function together so as to regulate…

Q: Provide a detailed description of gene expression and control in prokaryotes. Provide a detailed…

A: Gene expression is the mechanism by which information from a gene is used to create a functioning…

Q: Compare the control of gene regulation in eukaryotes and prokaryotes at the level of initiation of…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: c) You use chromatin immunoprecipitation to measure the location and amount of transcription factors…

A: Transcription factors are protein molecules which bind to specific DNA sequences to regulate gene…

Q: RNAP can access the lacZ promoter irrespective of whether CAP-CAMP is binding the CAP o True False

A: Lac operon is a set of structural genes regulated by a common promoter. It is found in bacteria.

Q: Consider a gene being transcribed at a constant rate k1 and being degraded with first  order…

A: The genetic information from protein synthesis is stored in DNA. This information is copied onto an…

Q: The following diagram show what is required for an active promoter of a gene of interest, where:A1 =…

A: Based on the given diagram, here are the predictions:Chromatin conformation: EuchromatinMethylation…

Q: You have isolated a mutant that you call Mutant Z. In a Mutant Z strain, the RNA polymerase can bind…

A: Here, the correct answer is option c) domain 2 of sigma and d) 3/4 linker of sigma.

Q: enhancer promoter trans-regulatory factor III = III DNA sequences near a gene to regulate its…

A: Gene Regulation :  A crucial biological mechanism known as transcriptional regulation enables a…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.