The only way that information is extracted out of DNA is through the transcription of MRNAS that code forproteinsTrueFalse Match the nutrient environment with the status of the transcription factors that regulate the lacoperon in E. coli.Lacl bound to lactose and CAP is boundV[Choose ]Low lactose, low glucoseHigh lactose, high glucoseHigh lactose, low glucoseLow lactose, high glucoseCAMP and the CAP-OLacl bound to the LacO and CAP boundCAMP and the CAP-OLacl bound to lactose and CAP unbound[ Choose ]by CAMP, not on the CAP-OLacl bound to the LacO and CAP unbound[ Choose ]by CAMP, not on the CAP-O

According to our guideline we can answer only the first question. So upload the second question…

Answered: The only way that information is…

The only way that information is extracted out of DNA is through the transcription of MRNAS that code for proteins True False

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3' Write the sequence of its complementary strand in the conventional 5' - 3' direction
The lagging strand of DNA is synthesized continuously in a 3' to 5' direction Discontinuously in a 5' to 3' direction Discontinuously in a 3' to 5' direction. In both 5' to 3' and 3' to 5'
When examining the genetic code, it is apparent that ________. there are 44 stop codons because there are only 20 amino acids there can be more than one codon for a particular amino acid AUG is a terminating codon the code is ambiguous in that the same codon can code for two or more amino acids there can be more than one amino acid for a particular codon
dna stored at physiological ph is negative charge single strand positive charge unchanged degraded
DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!) tRNA anticodon (No thymine in RNA!) Amino acid Use the mRNA with the Genetic Code. Use the mRNA with the Genetic Code. Answer the questions below. Questions How many nucleotides would be needed to code for a protein that has 100 amino acids? Using the Genetic Code in Table 6.3, write all of the possible codons that signal the start and end of a gene. Start: End: An amino acid sequence of a protein molecule includes methionine, lysine, serine and glycine. Show each different codon that could result in each of these amino acids. You will have more than one codon for all of them except methionine. Amino Acids All Possible Codons Methionine Lysine Serine (Look carefully. There are six possibilities) Glycine Question 3 illustrates the redundant nature of the genetic code. Can you think of an advantage of having several codons that all code for the…
What determines the sequence of nucleotides in the template strand of DNA? (The answer can be very basic don’t need lots of details)
Complete the box below: Convert the following template strand of DNA bases into its complementary mRNA molecule. Next translate the DNA into a polypeptide chain of amino acids using the Table above. CAATATGGAAGCCGACTCACCCTAATT
The following sequence of DNA is part of the normal, wild-type gene. 5'TAC CGG GAC TTG AGC CGA TAG 3' A deletion occurs during DNA replication, causing the guanine shown in red to be removed from the nucleotide strand. What effect is this most likely to have on the final protein? Multiple Choice The deletion of the G will cause a single amino acid substitution in the codon in which it occurs. The deletion of the G will cause a frameshift, so that the first amino acid after the mutation will change but the rest of the protein is unaffected. The deletion of the G will cause a frameshift, resulting in a premature stop codon and a truncated protein. The deletion of the G will cause a frameshift, resulting in the loss of the normal stop codon and an abnormally long protein with an altered amino acid sequence. The deletion of the G will not have an effect on the final protein.
Which of the following would be most likely to have a dramatic effect on the amino acid sequence of a protein? a two base deletion in an intron a one base insertion just after the start codon a three base insertion in an exon a one base insertion just before the start codon a single base substitution in a promoter
The most likely and immediate affect of the deletion of the Shine-Dalgarno sequence would be: Group of answer choices initiation of replication will not take place 50S subunit cannot form the initiation complex ribosomes will be unable to bind to mRNA mRNA will degrade more rapidly
More than one answer can be correct
True or False: Proteins are assembled two or three amino acids at a time during translation