Self-bonded and looped sequences near the end of single poly-ribonucleotide chains control gene expression by Forming promoters that begin transcription Forming promoters that begin translation Terminating translation of MRNA Terminating synthesis of an RNA transcript Signaling the binding of TRNA to ribosomes Causing binding of a Release Factor to a nonsense codon Activating RNA polymerase at a TATAA sequence O 00 O

Q: Which of the following is a feature of tRNA that is important for its function in translation? O The…

A: Ans : Most important feature of tRNA that is important for its function in translation is - the…

Q: How many tRNA molecules can associate with a ribosome at any given time during translation

A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…

Q: Prokaryotic cells can have more than one functional start codon per mRNA because  There are…

A: It is a multiple choice question

Q: EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in…

A: Introduction The Central Dogma states the formation of RNA from DNA and proteins from RNA.  The…

Q: codons are part of the molecular structure of

A:

Q: Addition of a 5'7-methyl guanosine cap to the primary RNA transcript during nuclear processing *…

A: In eukaryotes, the mRNA when transcribed from DNA comes as a pre-mRNA that undergoes the following…

Q: In the splicing of group I introns shown, does the 5′ end of the intron have a phosphate group?…

A: Introns are the inert elements in the DNA. They are otherwise said to be non coding regions of DNA…

Q: Which step in the processing of heterogeneous nuclear RNA (in eukaryotes), into mature messenger…

A: Most eukaryotic mRNAs contain a polyadenylate, poly(A), tail at that end, added after transcription…

Q: Which of the following types of mutations, resulting in a change in the mRNA just after the…

A: The translation process will result in the creation of proteins. The process of protein synthesis is…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: The "factory" itself, made of two [Choose] subunits [Choose] FRNA The site from which the growing…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase III III E - A compound with no electrical…

A: Chaperones are proteins that aid in the folding, assembly, and stabilisation of other proteins in…

Q: What would be the most likely effect of moving the AAUAAAconsensus sequence shown in Figure 14.7 10…

A: mRNA (messenger ribonucleic acid) is synthesized using DNA (Deoxyribonucleic acid) template. After…

Q: ICH one is the next tRNA that will arrive to the "A" site of this ribosome? 000000 Gly Arg Glu Pro…

A: The A site is where the next tRNA molecule carrying an amino acid binds to the mRNA. The tRNA…

Q: A poison added to an in vitro translation mixture containing mRNA molecules with the sequence 5'-…

A: In the process of protein synthesis, when the ribosome encounters the start codon (AUG) and…

Q: What happens if you replace the trp codons in the trp leader sequence with codons specifying…

A: If the tryptophan is replaced in the trp codon sequence with codons specifying isoleucine, the cell…

Q: In prokaryotic RNA synthesis the rate of incorporation of nucleotides is constant throughout the…

A: In prokaryotes, RNA synthesis is carried out the enzyme RNA Polymerase. RNA Polymerase read the DNA…

Q: Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O…

A: Thank you for the question  Answer :- The given picture shows translation termination Explanation :-…

Q: The figure provided in in the introduction above shows adenine being deaminated to form the…

A: Wobble hypothesis - is about the base pairing between nitrogen bases in 1st and 2nd positions of the…

Q: Is this diagram of tRNA technically incorrect? Shouldn't it be 3' on the left and 5' on the right…

A: The tRNA or the transfer acyl Ribonucleic Acid serves as an adapter molecule during the process of…

Q: Classify the following functions or structures as being attributed to proteins, RNA, or RNA-protein…

A: A. Proteins -  Poly A polymerase Release factors (RF1 and RF2) Formation (catalysis) of peptide…

Q: A tRNA that could “read” the 5’ GAA codon of glutamic acid would have the anticodon: Answer choices…

A: Transfer RNA (tRNA) is a type of RNA molecule that plays a crucial role in protein synthesis by…

Q: The piece of eukaryotic mRNA below includes the region that codes for the binding site for the…

A: Transfer RNA, or tRNA, plays a crucial role in protein synthesis. It acts as a carrier, delivering…

Q: None

A: Here is the matching of each aspect of transcription or translation with the appropriate motif,…

Q: How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks…

A: Translation Translation involves the answer of information in mrna molecules into the amino acid…

Q: 5' cap amino acid aminoacyl tRNA synthetase anticodon codon EF-Tu-GTP EF-Ts eukaryote Kozak…

A: Three process combined together to form a central dogma that is replication where copy of genetic…

Q: Which of the following is not true?   There are two major classes of aminoacyl-tRNA synthetases…

A: Central dogma includes three main processes Replication, Transcription, and Translation.…

Q: Which of the following processing events occur during or after the synthesls of MRNA molecules in…

A: Transcription  It is the process of makin copy of RNA from DNA. This RNA is known as messenger RNA

Q: DNA RNA Triplet codon Transcription Translation TATA box Start codon RNA processing 5' cap poly A…

A: Introduction  DNA is a double-stranded molecule with a lengthy sequence of nucleotides. A…

Q: Splice sites on mRNAs are located with the help of all of the following EXCEPT:   Question 9…

A: Introns are cut off at splice sites along a pre-mRNA sequence, and exons are connected at these…

Q: Vaccina virus (used in the polio vaccine) produces an enzyme that takes the 5’ cap off of the mRNAs…

A: The 5'-G caping is only found in the eukaryotic mRNA. This is the result of post transcriptional…

Q: Which of the following statements about the post-translation modification of proteins by…

A:

Q: What is the purpose of the underlined sequence?   5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG…

A: In molecular biology, understanding the purpose of specific nucleotide sequences is crucial for…

Q: The synthesis of a protein requires that the amino acids that constitute the growing polypeptide…

A: In the intricate dance of cellular processes, protein synthesis takes center stage, orchestrating…

Q: After the entire coding sequence of a protein has been decoded and the peptide chain is synthesized,…

A: Translation is a process of protein synthesis. It is completed in three steps-  Initiation…

Q: Genetic expression involves transcription and translation. Match the structure or molecule to the…

A: We all know that central dogma is a very basic and important procedure in every cell.There are…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.