Reading frame Frameshift Initiation factors Elongation factors Release factors E ||| Proteins that bind to a nonsense codon on mRNA and halt translation. Tagging defective proteins with 3 or more ubiquitins will target it for destruction. Destroys defective proteins that have been polyubiquitinated. A reversion of a mutant back to wild type function. A mutation such as an indel that shifts the triplet reading frame to a different series of nucleotides altering every downstream codon from that point onward. Ope

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: Introduction :- mRNA stands for messenger RNA. The nucleus uses the nucleotide sequence of DNA as a…

Q: Which of the following events would NOT result in ribosomes stalling on an MRNA during translation?…

A: A release factor is a protein that recognizes a stop codon in an mRNA sequence and causes…

Q: From the picture provided, which colored option (exon variant) will give me: 1. start codon 2.…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: A codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense…

A: Information in the gene tell the cell to make a particular protein. This information is encoded in…

Q: Which of the following statements about translation is false?     In eukaryotes, the 5' cap and…

A: In molecular biology, the process by which the gene information in the DNA gets converted into a…

Q: Self-bonded and looped sequences near the end of single poly-ribonucleotide chains control gene…

A: Gene is the sequence of nucleotide that encodes a specific protein.

Q: Which of the following statements regarding "start" and "stop" signals apply to both transcription…

A: Introduction  The process of synthesising RNA from a DNA template, known as transcription, converts…

Q: Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical…

A: Introduction 1. Hydrogen bonds are a type of attractive interaction between an electronegative atom…

Q: EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in…

A: Introduction The Central Dogma states the formation of RNA from DNA and proteins from RNA.  The…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: The type of RNA modification that requires guide RNAs is ________.

A: Hi, Thanks For Your Question.  Answer : Correct Answer Is RNA Editing Explanation : RNA Editing Is…

Q: Which of the following does NOT happen during translation initiation? The mRNA binds to the small…

A: Translation: It is provess via which the protein is synthesized by the ribosomes after tye process…

Q: Indicate which of the following items are associated with transcription or translation.  This could…

A:

Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…

A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…

Q: You are observing the translation process in a eukaryotic cell that has been exposed to an unknown…

A: Translation is the process by which the genetic information encoded in mRNA is used to synthesize…

Q: During translation elongation cycle, which of the following step(s) is/are repeated for each amino…

A: Translation is a process by which proteins are synthesized from mRNA template. It involves all the…

Q: A reversion is a mutation that returns a mutant codon back to acodon that gives a wild-type…

A: A mutation is a change in the DNA sequence, either due to mistakes during DNA replication or because…

Q: Drag the functions involved in the bacterial translation process into the appropriate box with the…

A: IF1 Answer :  Prevents entry of an amino acyl trna into the ribosomeA site during the early initial…

Q: A mutation is found in a tRNA-encoding gene. The wild type (non-mutant) allele (version) produces a…

A: tRNA (transfer RNA) is a type of RNA that helps decode the genetic information in mRNA to build…

Q: Introns are intervening sequences; what are exons?

A: A gene is an essential unit of heredity and a sequence of nucleotides in DNA or RNA that encodes the…

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O…

A: Thank you for the question  Answer :- The given picture shows translation termination Explanation :-…

Q: Which term describes each of these steps or substeps in the translation process? The ribosome shifts…

A:

Q: Classify the following functions or structures as being attributed to proteins, RNA, or RNA-protein…

A: A. Proteins -  Poly A polymerase Release factors (RF1 and RF2) Formation (catalysis) of peptide…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: The process of synthesis of proteins from mRNA is called as translation while the process of…

Q: Prokaryotic Eukaryotic FRNA MRNA TRNA hnRNA snRNA FRNA get of zibiotic ugs pped to pid Terioration…

A: Introduction :-  RNA is a polymeric molecule . Role of RNA  in different cellular processes ==…

Q: Transcription and translation are separate processes in gene expression; however, they have…

A: In living organisms, the genetic instructions for growth, development, functioning, and reproduction…

Q: How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks…

A: Translation Translation involves the answer of information in mrna molecules into the amino acid…

Q: What type of RNA corresponds to the statement? Prokaryotic Eukaryotic FRNA MRNA TRNA hnRNA RNA FRNA…

A: RNA or Ribonucleic acid is one among different biomolecules. They are also composed of nucleotides;…

Q: Which of the following processing events occur during or after the synthesls of MRNA molecules in…

A: Transcription  It is the process of makin copy of RNA from DNA. This RNA is known as messenger RNA

Q: The initial step in the protein translation is described by: O release of the initiation factors…

A: There are 4 Biomacromolecules. They are ; Proteins Nucleic acids Carbohydrates and  Lipids

Q: Splice sites on mRNAs are located with the help of all of the following EXCEPT:   Question 9…

A: Introns are cut off at splice sites along a pre-mRNA sequence, and exons are connected at these…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Vaccina virus (used in the polio vaccine) produces an enzyme that takes the 5’ cap off of the mRNAs…

A: The 5'-G caping is only found in the eukaryotic mRNA. This is the result of post transcriptional…

Q: In the elongation stage of translation, which of the following options is correct? the polypeptide…

A: The Central Dogma of molecular biology refers to the flow of information from DNA to RNA to…

Q: For each mutant, state what change has occurred in the DNA, whether it was a substitution by…

A: CODONS 3 4 5 6 7 8 9   NORMAL PRO THR VAL THR THR ARG TRP   CODON CCC ACG GUG ACG ACA CGG UGG…

Q: All of the following EXCEPT which one occurs between transcription and translation. -Introns are…

A: Transcription is a process of coping down information from DNA to RNA. Translation is a process…

Q: After the entire coding sequence of a protein has been decoded and the peptide chain is synthesized,…

A: Translation is a process of protein synthesis. It is completed in three steps-  Initiation…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: As per the central dogma of molecular biology information stored within the DNA is transcribed onto…

Q: Which of the following statements regarding "start" and "stop" signals apply to both transcription…

A: Introduction  A two-step technique is used to express the genes that code for proteins. A gene's DNA…

Q: A segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid…

A: Introduction   Genetic code or codon is a three nucleotide sequence present on mRNA. It gives the…

Q: Which of the following are elongation factors involved in the attachment of new aminoacyl-tRNAs?…

A: During translation protein synthesis occurs from RNA. The sequence of nucleotides in RNA act as code…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.