Pre-tRNA,Met tRNA, Met No DNA Mutant gene Wt gene M 1 2 3 4 5 6 7 8 9 1. Why was [a-32PIGTP used in this experiment? 2. What material generates the smear in the upper region of the autoradiograph? Why is this smear absent from the marker? 3. How does the mutation affect the transcription of the microinjected gene? 4. How does the mutation affect the processing of the primary transcripts? 5. How does the mutation affect the nucleocytoplasmic transport of tRNA Met? Samples: Marker M: 32P-labeled primary transcript No exogenous DNA injected 1: whole oocyte 2: nuclei 3: cytoplasm Mutant gene injected 4: whole oocyte 5: nuclei 6: cytoplasm Wild-type gene injected 7: whole oocyte 8: nuclei 9: cytoplasm

Pre-tRNA,Met tRNA, Met No DNA Mutant gene Wt gene M 1 2 3 4 5 6 7 8 9 1. Why was [a-32PIGTP used in this experiment? 2. What material generates the smear in the upper region of the autoradiograph? Why is this smear absent from the marker? 3. How does the mutation affect the transcription of the microinjected gene? 4. How does the mutation affect the processing of the primary transcripts? 5. How does the mutation affect the nucleocytoplasmic transport of tRNA Met? Samples: Marker M: 32P-labeled primary transcript No exogenous DNA injected 1: whole oocyte 2: nuclei 3: cytoplasm Mutant gene injected 4: whole oocyte 5: nuclei 6: cytoplasm Wild-type gene injected 7: whole oocyte 8: nuclei 9: cytoplasm

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 37CTQ: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding...

See similar textbooks

Similar questions

Please asap
Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'
Transcribe and translate the mutated sequence # 2. Determine the consequence, if any, for each mutation. You wi ISN. Practice with both charts. Original DNA sequence: mRNA transcript: amino acids: Mutated DNA sequence #2: mRNA transcript: (Circle any changes) amino acids: Type of mutation (Circle one.) How did the mutation affect the amino acid sequence (protein)? (Circle all that apply.) #ARG Point TAC AUG METH TAC Silent (No change) || || CUG #PRO ACC UGG TRP GAC Substitution Missense (1 amino acid changed) #AUG TTG AAC ASN ASN CTT Nonsense (Premature stop) signal GCG CGC ARG GGC Frameshift No stop signal ACG UGC CYS GAC GAC # CCG #GAA #GLU Inserti 1 amino ac added/ deleted LE
Match the following (most appropriate combinations): Gel filteration chromatography Electrophoresis Transition mutation Transversion mutation Missense mutation Frameshift mutation Southern blot Northern blot Western blot Separation of molecules in el [Choose ] Detection of protein Detection of RNA Causes triplet codons to be out of phase Detection of DNA Separation of molecules in electric current ✓ G changed to T C changed to T Separation of proteins in a column based on size Changes one amino acid codon into another Changes one amino acid co Detection of DNA Detection of RNA Detection of protein
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
To determine the reproducibility of mutation fre-quency measurements, you do the following experiment.You inoculate each of 10 cultures with a single E. coli bac-terium, allow the cultures to grow until each contains 106cells, and then measure the number of cells in each culturethat carry a mutation in your gene of interest. You were sosurprised by the initial results that you repeated the experi-ment to confirm them. Both sets of results display the sameextreme variability, as shown in Table Q5–1. Assuming thatthe rate of mutation is constant, why do you suppose thereis so much variation in the frequencies of mutant cells indifferent cultures?
B 6000 5100 Number of Fragment(s) 4000 100 pX 6000 bp 3000 A A 1500 2000 A B 10. Based on the restriction map of the above plasmid, determine the number of DNA fragment(s) and the size(s) of the fragment(s). Digestion with Enzyme A Enzyme B Enzyme C Enzyme A + B Enzymes A + C Enzyme B+ C Enzyme A + B + C Fragment size(s) in base pairs
Please send me the question in 20 minutes it's very urgent plz
I would like you to solve question 12.
DNA and Protein Synthesis Retake Test Using the chart below, what type of mutation would take place if the highlighted and underlined "A" was deleted?: What amino acid sequence would be coded for with this mutation? What would be the affect of this mutation on the organism? i DNA AAT СТА GTA MRNA UUA GAU CAU Amino acid Leu Asp His :: point mutation :: frame shift mutation :: no affect on organism :: affect on organism : Leu - Asp - His :: Leu - Asp - Asp : Stop - lle - ? : Tyr - Met -? 18 19 20 21 22 23 24 25 96