Using the chart below, what type of mutation would take place if the highlighted and underlined "A" was deleted?| What amino acid sequence would be coded for with this mutation? What would be the affect of this mutation on the organism? DNA AAT CTA GTA MRNA UUA GAU CAU Amino acid Leu Asp His : point mutation : frame shift mutation : no affect on organism : affect on organism : Leu - Asp - His : Leu - Asp - Asp : Stop - lle - ? : Tyr - Met -?

Q: al mRNA: 5’- AUG GGC UCG ACC UUG -3’ Mutant mRNA 1: 5’- AUG GGC UAG ACC UUG -3’ Mutant mRNA 2: 5’-…

A: The physical and functional unit of heredity is the gene. They pass on knowledge from one generation…

Q: Which of the above mutations will result in a shift in the reading frame

A: Mutations in a cell can be of several types: Chromosomal mutations - where one of the chromosomes in…

Q: With this gene provided: MuPKS c.1949 C>T (p.R644W) Please provide the following; 1. Name of the…

A: The DNA is formed of two nucleotide chains joined through a hydrogen bond formed between the…

Q: 3) mutated:3' TA C A CC TTG coA CGA CTA'S MRAA transcript: AuG uCG AACGCU Gcu GAu. amino acid:…

A: A mutation is a change in the DNA sequence of an organism. Mutations can result from errors in DNA…

Q: You suspect a protein that is being expressed has been affected by a mutation.  When you examine the…

A: mutations in the DNA sequences is of many type and can effect the sequence of transcribed mRNA and…

Q: Question 10 Review mutations. Match the term and its description. Each term can only be used once.…

A: change in just one nucleotide pair is called a point mutation  the mutation that does not have an…

Q: DNA Sequence:     TAC  TCC  GGC  TCT  CCC  AGT  TGA  ACT Mutated Sequence: TAC  TCT  GGC TCT  CCA…

A: Any modification of a cell's DNA sequence. Mutations can occur as a result of errors made during…

Q: Ile Leu Giy Leu Lev Ser Gy Gr LBU Aa Met Ile Leu Met GY Ser Tor Gy Glu Mutation #3 mutation # 4A lle…

A: Spontaneous changes in the DNA nucleotides sequences is called muttai. it is of many times such as…

Q: The type of RNA modification that requires guide RNAs is ________.

A: Hi, Thanks For Your Question.  Answer : Correct Answer Is RNA Editing Explanation : RNA Editing Is…

Q: If a gene for a polypeptide has a mutation that causes an amino acid change but the new amino acid…

A: Mutation is molecular change in the DNA sequence of a gene. Mutations in the coding sequence of a…

Q: Which two of the following gene mutations would have the highest likelihood of causing a severe…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: A nonsynonymous mutation is also referred to as missense mutation. Which of the following correctly…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: Which mutation would most likely cause the greatest impact

A: A mutation occurs when the DNA sequence modifies. Mutations can occur as a result of errors in DNA…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: Which of the following point mutations would properly be defined as a transition mutation?  the…

A: The substitution mutations of DNA are of two types: Transitions and Transversions. Transitions are…

Q: What happens if you replace the trp codons in the trp leader sequence with codons specifying…

A: If the tryptophan is replaced in the trp codon sequence with codons specifying isoleucine, the cell…

Q: Select all the possible mutation types for the following observed phenotype resulting from a…

A: Need to find which of the following mutation is happened in protein to express in wrong cell

Q: Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA…

A: In the process of protein synthesis, DNA is transcribed into mRNA. Complementary base pairing rules…

Q: If the wild-type codon is GUU, which of the following single-nucleotide polymorphisms lead to a…

A: Understanding the impact of single-nucleotide polymorphisms (SNPs) on amino acid sequences is…

Q: If the DNA sequence that coded for a codon that was complimentary to the ANTICODON AAU underwent a…

A: A mutation may be a change within the sequence of DNA. Mutations can occur as a result of the term…

Q: missense,

A: 1. Non- conservative missense mutation occur , when G was substituted with C .

Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…

Q: In humans, sickle-cell anemia and hemophilia represent which type of mutations?     Loss of…

A: Mutations are of different types. Mutations are change in the sequence of DNA which may cause the…

Q: Which of the following is/are a transition mutation(s)? (select any that apply) A to T   A to G   C…

A: Point mutations refer to the change of a single nucleotide. These can be single base substitution or…

Q: What happens when EF-Tu is mutated? Choose from the options below. Be involved in transcription…

A: Elongation Factor Thermo Unstable (EF-Tu) is one of the most prevalent proteins in bacteria, making…

Q: Describe the mutation that occurs in the following examples (be specific, if possible): BOAT  to BAT…

A: Mutations are changes or alterations or modifications in the nucleotide sequence of the genome or…

Q: A point mutation within a codon that does not change the resulting amino acid sequence is known as…

A: Mutation is a change of nucleotide sequence of DNA. When there is a change in single nucleotide of…

Q: hutations in a structural gene (coding for a protein) have a null phenotype. How many different…

A: Nonsense mutations : It is a genetic mutation in a DNA sequence that results in a shorter ,…

Q: A nontemplate strand of bacterial DNA has the base sequence 5'-ATGATACTAAGGCCC-3' Determine the…

A: The central dogma of molecular biology describes the flow of information in biological systems.  It…

Q: The following is a polypeptide from a wild type organism: met – ser – tyr – his – trp – arg – ser –…

A: Mutation is any sudden change resulting in an abnormal structure.  The given polypeptide chain is,…

Q: Upon going through the complete process of gene expression, which amino acid would be most likely to…

A:

Q: How many different single-nucleotide substitutions* (changing one nucleotide to another) in the DNA…

A: The single nucleotide substitutions that can occur to result in a non-sense mutations are -  i) CAA…

Q: What new amino acids might be substituted for proline after treatment with 5-BUDR?  (This mutagen…

A: Any physical or chemical or biological agent capable of altering DNA sequences is called a mutagen.…

Q: Which of the following statements about a transversion mutation in the sequence AGC is true?

A: Transversion alludes to a point mutation in DNA in which a solitary (two rings) purine is changed…

Q: three different types of loss of function mutations and in each case explain how the mutation exerts…

A: A mutation is any alteration of the base sequence of the DNA or RNA. Since mutation alters the base…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.