If the wild-type codon is GUU, which of the following single-nucleotide polymorphisms lead to a silent mutation in the amino acid sequence? GCU GUC GUG UUU GGU AUU □ GAU D CỰU GUA

Q: A gene contains 30% thymine. What is the percentage of pyrimidines present in this segment? Explain.

A: Purines and pyrimidines are chemical molecules that play a role in the production of DNA and RNA and…

Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…

A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence so that the…

Q: Why is deleting one nucleotide generally more detrimental than deleting three?

A: Nucleotides are monomeric units of nucleic acids.They are phosphate esters of nucleosides and made…

Q: If a single strand of a gene contains 678 bases, how many amino acids result in the polypeptide…

A: The biochemical substance that is carried from the preceding generation to the succeeding generation…

Q: please answer the question provided in the picture about the black allele gene asap please

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: type of mutation

A: If the sequence was mutated from CACGTAAAG to become CACCGTAAAG; single nucleotide insertion…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: The Universal Genetic Code Table can be used to determine the gene product of a given nucleotide…

A: mRNA consist of mononucleotide sequence that specifies amino acids sequence in peptide chain. One…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…

Q: In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures…

A: Cruciform DNA is a form of non-B DNA that requires at least a 6 nucleotide sequence of inverted…

Q: What is the consensus sequence of the following six DNA…

A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…

Q: A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the…

A: To explain--M1: Met-Ser-Ser-Arg-Leu-Glu-GlyThis mutation involves the substitution of Pro with Ser.…

Q: A reversion is a mutation that returns a mutant codon back to acodon that gives a wild-type…

A: A mutation is a change in the DNA sequence, either due to mistakes during DNA replication or because…

Q: a. Write the template DNA (complementary strand) sequence for the wild type gene above  b. Write…

A: The coding strand is complementary to the template strand.  The template strand is the DNA sequence…

Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…

A: The cell is the basic structural and functional unit of the body. The nucleus is called the brain of…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…

Q: missense,

A: 1. Non- conservative missense mutation occur , when G was substituted with C .

Q: The DNA of a deletion of alpha bacteriophage has a length of 15 micrometers instead of 17…

A: The bacteriophage is those viruses that have the capability to infect bacteria and reproduce inside…

Q: Define FOUR (4) types of point mutations within coding sequences

A: Coding sequences are the sequence of nucleotides in DNA capable to produce a protein. Many mutations…

Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…

A: Mutations are the changes in the genome resulting in synthesis of different products. These changes…

Q: Which of the following DNA strands, the top or bottom, would serve as a template for RNA…

A: Transcription is the process of making an RNA copy of a gene sequence. This RNA copy is called a…

Q: The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence…

A: The Central Dogma concept states that DNA is duplicated into DNA. RNA is formed from DNA and…

Q: The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide…

A: Transcription is the process of converting a portion of DNA into RNA. RNA polymerase is the enzyme…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: If the code were a sextuplet (containing of six nucleotides), would the reading frame be restored by…

A: A frameshift mutation is induced by adding or deleting several nucleotides in a DNA sequence that is…

Q: In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash…

A: DNA is a genetic material in most of the organism. It is two stranded ladder like structure which…

Q: Assuming the genetic code is a triplet, what effect would the addition or loss of two nucleotides…

A: The process in which the messenger ribonucleic acid (mRNA) molecule sequence is translated to form…

Q: What is the biological significance of the extensive degeneracy of the genetic code?

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Which of the following statements about a transversion mutation in the sequence AGC is true?

A: Transversion alludes to a point mutation in DNA in which a solitary (two rings) purine is changed…

Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…

A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…

Q: Based on the information in Figure, which single-nucleotide mutationevent is more likely:…

A: Genes are the unit of hereditary that codes for amino acids responsible for the formation of…

Q: When the sequence CpG occurs, the cytosine can be methylated. If a methylated cytosine is then…

A: Introduction CpG islands:- The CpG sites are a portion of DNA where a guanine nucleotide present…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Introduction : Transcription is the process in which a DNA sequence is transcribed into an RNA…

Q: BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would…

A:

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: A standard codon table such as the one that we looked at in class gives the following information:

A: Three types of RNA interact to synthesize proteins. They are mRNA, tRNA, and rRNA.mRNA is the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.