Question 10 Review mutations. Match the term and its description. Each term can only be used once. changes in just one nucleotide pair of a gene | Choose ) These mutations have no effect on the amino acid produced by a codon because of redundancy in the genetic code | Choose These mutations still code for an amino acid, but not the correct | Choose | amino acid These mutations change an amino acid codon into a stop codon: most lead to a nonfunctional protein | Choose In this mutation, insertion or deletion of nucleotides may alter the reading frame | Choose | additions of nucleotide pairs in a gene [ Choose > > > > >

Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…

A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…

Q: i just want an answer to question g please make sure it's correct.

A: The DNA nucleotide sequence provided in the image is the template for synthesizing a protein. To…

Q: Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence…

A: A gene is a segment of DNA that contains the necessary information for the synthesis of a functional…

Q: Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point…

A: When a point mutation occurs, one of three things may happen:Due to the mutation occurring in a…

Q: Question 2 Which example is describing a "missense" mutation? OThe normal amino acid sequence of a…

A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

Q: QUESTION 13 You have isolated a nonsense mutation caused by a base substitution. This mutation is a…

A: Nonsense mutation: These mutations change a codon in a gene to one of the three termination codons…

Q: AUG is the most common start codon found in translated genes. Which of the following is true of…

A: The start codon is the initial set of codons in an mRNA transcript that is translated by a ribosome.…

Q: thymine nucleotides

A: Nucleic acids:These are long linear polymers that carry information that can be passed from one…

Q: Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and…

A: Codons It refers to the sequence of three consecutive nucleotides that are present in the DNA or RNA…

Q: QUESTION 9 Shown is a segment of DNA with its promoter and terminator. Start and end of…

A: Given: Segment of RNA with exons and introns of length: Intron 1: 15 Intron 2: 17 Intron 3: 14 Exon…

Q: Question 4. Which enzyme is used in the processing of miRNAs that are encoded in the genome but NOT…

A: Non coding RNAs (ncRNAs) like as microRNAs and small interfering RNAs (siRNAs) play important roles…

Q: In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence of the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like helical structure which acts as genetic…

Q: stop codon. C Chr1 Bace2 180 180 Exon 1 Exon 2 Exon 3 Exon 5 Exon 7 Exon 9 Exon 4 Exon 6 Exon 8 200…

A: Nucleotides in DNA are arranged in exons or introns. Exons are the coding sequence whereas introns…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: The mRNA is produced by the process of transcription. It takes place in the nucleus. The RNA…

Q: All are stages in transcription EXCEPT: A chain termination. B DNase I activity on RNA…

A: Transcription is the process of conversion of RNA to proteins. It involves 3 steps initiation…

Q: Choose best match of the events that occur during translation with their locations in the E. coli…

A: Translation is the process by which the genetic code on messenger RNA (mRNA) molecules is decoded to…

Q: Practice question #1 (Fill in parts A, B, and C) 1. Within the cytoplasm or ER, are synthesized by…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

A:

Q: Question 5. You are interpreting data on a DNA chip, or microarray. You expose the chip to a mixture…

A: A microarray is a collection of probes or oligos attached to a chip. Microarray is employed to…

Q: Correct! The Leu codon is changed to a nonsense codon by a single-base substitution How many…

A: The process by which mRNA is produced from DNA is called transcription and the process by which…

Q: QUESTION 4 Suppose you have a length of DNA sequence that corresponds to a complete mRNA open…

A: Q4. The correct option is D i.e, look for splice sites GT-AG thise should only be present if the DNA…

Q: QUESTION 9 In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence…

A: Abrupt changes in the DNA sequences are called mutations. these may or may not change the protein…

Q: What is the smallest number of molecules of ATP and GTP consumed in the synthesis of a protein with…

A: The process of gene expression requires two steps: transcription and translation. Translation is the…

Q: Teminator Promoter Gene (DNA) AUG UA Exon 1 Exon 2 Exon 3 Exon 4 Intron 1 Intron 3 14 Intron 2 15 15…

A: To initiate transcription, RNA polymerase binds to the promoter, so the promoter helps in…

Q: Task 2: Review the process of protein synthesis by placing the cards in their appropriate category.

A: The protein synthesis is the anabolic process of the synthesis of the protein by the polymerization…

Q: UUUUU..3' Rho-independent (intrinsic) terminators in bacterial transcripts consist of a sequence…

A: Intrinsic terminators, often referred to as rho-independent terminators, are sequence patterns…

Q: Question 9 of 10 Question 9. If a mutation occurs such that there is a duplication of the A in the…

A: Introduction :- Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that corresponds…

Q: 2. A polypeptide for a gene has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The…

A: A mutation is a permanent change in the DNA sequence that makes up a gene. Mutations can have a…

Q: Which types of mutations, among those you created in this activity, are more likely to cause the…

A: A mutation is a change that occurs in an organism's DNA sequence. Errors in DNA replication,…

Q: QUESTION 1 Shown below is the 5' end of an mRNA. Translation of this mRNA should begin at nucleotide…

A: mRNA consists of different three nucleotide codons that will eventually code for different amino…

Q: You are studying the regulation of the enzyme 3-phosphoglycerate dehydrogenase (3PGD). This is the…

A: Serine is a non-essential amino acid that means it is produced by our body. It is present in almost…

Q: gea albbiM Obj 29 Identify the specific terms applied to transcription and translation described by…

A: Transcription and translation are two critical processes in the central dogma of molecular biology.…

Q: - up to 2 minutos): Which of the following statements about the genetic code is(are) true? OA Each…

A: Genetic code: It is a dictionary that involves a sequence of nucleotides and amino acids which is…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.