How many proteins are possible in a gene with 4 exons?• Label the exons A, B, C, and D.• Draw out the possibilities• Hint: list the singletons, the doubles, the triples, etc General formula: 2n-1• Why the -1? And how can you find that without using the general formula

How many proteins are possible in a gene with 4 exons?• Label the exons A, B, C, and D.• Draw out the possibilities• Hint: list the singletons, the doubles, the triples, etc General formula: 2n-1• Why the -1? And how can you find that without using the general formula

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 3TYK

See similar textbooks

Related questions

Q: True or Falso: in meiosis the intermediate cells formed after meiosis I are haploid going into…

A: Meiosis is a type of cell division that results in four daughter cells each with half the number of…

Q: If an mRNA sequence begins 5'-GGACGUAGA...-3', which of the following sequences would continue that…

A: Hairpin loop is formed when the two mRNA strands have complementary sequences at their ends that's…

Q: Hello, What curiocity can you tell me about Methicillin-resistant Staphylococcus aureus? Thank you…

A: Further readings:…

Q: Describe toxicological concepts used in occupational health.

A: Toxicology is the scientific study of adverse effects that occur in living organisms due to…

Q: QUESTION 11 Which of the following statements about resolution is true? O A. Resolution refers to…

A: In the context of microscopy, resolution refers to the ability of a microscope to clearly…

Q: 2. Neurons use action potentials to send information down the axon to stimulate a release of a…

A: 2(a) Definition of Action Potential: An action potential is a rapid and temporary change in the…

Q: How does the hypothalamus control and regulate the endocrine system? Describe the difference between…

A: You can start by familiarizing yourself with the table below, showing an overview of the…

Q: Biology B Tutorial Seven- Nervous and Endocrine System Tutorial 7 (Week 10) - Nervous and Endocrine…

A: Question 1: Identification and Role of Neuron PartsDendrites: These are branch-like structures that…

Q: Below is the cDNA (coding DNA) and amino acid sequence Human Insulin: 1…

A: Understanding the Genetic Code: A Colorful AnalogyImagine the DNA molecule as a long, twisted…

Q: QUESTION 24 An iatrogenic disease has unknown causes can be caused by treatment in a medical…

A: An iatrogenic disease is a condition that is caused by medical personnel or procedures, or that is…

Q: 1.) What process is shown here?2.) Label the structures- components that the arrows are pointing to…

A: The diagram illustrates an mRNA bound to the ribosome. The tRNA molecules, each carrying specific…

Q: Hello, Do you think you can help me to find what disorder they are talking about?: Major…

A: Detailed explanation:Based on the provided description and clinical findings, the disorder in…

Q: Would an antibiotic that targets cell wall synthesis have more or less toxic side effects than one…

A: An antibiotic that targets cell wall synthesis is generally less toxic to human cells than one that…

Q: 1. The mature transcripts that represent normally spliced products 2. The mature manuscript that…

A: 1. Mature transcripts representing normally spliced products are those where introns are removed and…

Q: Review article abstract and abstract generated by Chat GPT and identify three issues present in the…

A: Reference:https://pubmed.ncbi.nlm.nih.gov/25211222/

Q: The orgigin of the jaw in gnathostomes is: cranium, hyoid, gill arch or notochord

A: Before we answer the question, let's understand the terms. Gnathostomes are a superclass of animals,…

Q: Which is the only vertebrate osmoconformer? Bird, hagfish,rabbit or none?

A: An osmoconformer is an organism that maintains its internal environment isosmotic with its external…

Q: Hello, Can you please help me with this question about Salmonella? How does this microorganism…

A: For the most part, Salmonella bacteria reproduce by a mechanism known as binary fission, which is a…

Q: A purple probably die. ning Absorption spectra of photosynthetic pigment B Absorption Chlorophyll…

A: A purple plant containing only bacteriochlorophyll would likely have limited photosynthetic…

Q: Can someone please help answer the two questions below based on the given scenario thanks! What can…

A: Question 1: What can James accurately conclude from the data shown? The data provided shows various…

Q: Don't use Ai. Answer in step by step with explanation.

A: Detailed explanation: :Step 1: Understanding the QuestionThe question states: "In teaching labs, we…

Q: This transcript (s) code(s) for the largest protein isoform.

A: What the image represents:The image shows the structure of a gene with six exons (numbered 1 through…

Q: Biology Question What are the correct labels of the plant cell showed in the attached picture?

Q: What do ovalbumin (from egg whites) and myosin (from human muscle) have in common?

A: Ovalbumin is the main protein found in egg whites, making up approximately 54% of the total protein…

Q: 1. Using the figure below of a cell in an aqueous solution, draw an arrow that represents the net…

Q: Which endocrine gland and/or hormone do you think is most important and would be most difficult to…

A: The endocrine system consists of several glands that regulate numerous bodily functions through…

Q: Answer in step by step with explanation. Don't use Ai and chatgpt. Answer in all options.

A: 1. Immune System Mitigation to Prevent Autoimmune DiseasesStep 1: Immune Tolerance DevelopmentThe…

Q: QUESTION 13 Selective toxicity: Oa. harms the microbes without significantly harming the host. O b.…

A: Selective toxicity is a fundamental concept in pharmacology and microbiology. It refers to the…

Q: Describe the applications of epidemiology and toxicology in occupational health.

A: Epidemiology is the study of how often diseases occur in different groups of people and why. It…

Q: At right are pictures showing a part①Fully relaxed sarcomere of a muscle fiber of a skeletal muscle…

Q: 00:54 TET. 4. 49% NW NSC LFSC P1...NG SEPT 2024.pdf - Read-only K the investigation. The diagram…

A: A comprehensive response, complete with appropriate explanations and reasoning has been provided in…

Q: What are the two general mechanisms by which histone acetylation affects transcription?

A: 2.Recruitment of Transcription Factors: Acetylated histones can serve as binding sites for…

Q: 2). In bullhead catfishes, the nuclear DNA locus R is a species marker (does not determine species!…

A: In this cross, we are considering a female catfish with the genotype Rr (nuclear DNA) and mtDNA…

Q: Which of the following scientific investigations may use a compound light microscope? (check all…

A: A compound light microscope is a type of microscope that uses light and lenses to magnify images. It…

Q: 6751 bp 3652 bp 2827 bp 1568 bp 1118 bp 825 bp 630 bp M CS1 CS2 1 (-) 2 3 4 ☐ Π (+) Lane Tube…

A: Bands Present in Suspect #2 (cut with Enzyme 1):600 bp1500 bp3700 bpExplanation:In the image, we see…

Q: How is energy captured, stored used in microbial cells in terms of thermodynamics?

A: In terms of thermodynamics, energy in microbial cells is captured, stored, and used through a series…

Q: Answer in step by step with explanation. Don't use Ai and chatgpt. Answer in all options.

A: A Punnett square is a tool used in genetics to predict the potential outcomes of a genetic cross by…

Q: Answer 1 question please!

A: Feel free to ask for clarification

Q: 4-Hello, Can you please help me with the next question? How would an understanding of Enterobius…

A: Note: Hello, student. I sincerely hope I was able to answer your question, you are free to edit…

Q: Biology Question

A: It looks like you've uploaded an ECG image. To provide a meaningful analysis or answer a question…

Q: 3. If you were to perform the Sudan IV stain on egg whites and egg yolk, which of the two would you…

A: Used for the staining of lipids, triglycerides, and lipoproteins on frozen paraffin sections, Sudan…

Q: The human kidney helps control water and electrolyte balance and excretion of nitrogenous wastes. As…

A: The image you provided outlines several potential treatments for type 2 diabetes that aim to alter…

Q: Biology Questions The questions are showed in two attached pictures

A: Question 1 (Part b)➜Determine the predicted phenotype ratio in children of a woman who is dihybrid…

Q: Can you label each fragment part with A or P? These are restriction fragments cut by Ava II and Pvu…

A: Here is a suggested labeling:For the top set:1.209: Likely Ava II (A)2.464: Likely Pvu II (P)0.933:…

Q: Biology Questions The questions are showed in two attached pictures

A: b: True or False QuestionsA type O child may have two type A parents.True. Both type A parents could…

Q: Which of the following would lead to a rise in hematopoiesis? A) Nutrient-deficient diet B)…

A: The correct answer is C) An infection.Here's why:Infection: When the body is fighting an infection,…

Q: How do I calculate the mean, variance and the standard deviation from this table?

A: To calculate the mean, variance, and standard deviation for this table of data, follow these steps:…

Q: In some plants, a purple pigment is synthesized from a colorless precursor. In a cross between two…

A: The question is asking us to determine the mode of inheritance and the phenotypic ratio based on the…

Q: What is the significance of the electron transport chain in microbial metabolism in terms of the…

A: The electron transport chain (ETC) is a key player in microbial metabolism, acting like a cellular…

Q: This is the place to interpret your results and state whether or not your data supported your…

A: Data AnalysisThe data reveal statistically significant differences between the survivor and victim…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

How many proteins are possible in a gene with 4 exons?
• Label the exons A, B, C, and D.
• Draw out the possibilities
• Hint: list the singletons, the doubles, the triples, etc

General formula: 2n-1
• Why the -1?

And how can you find that without using the general formula

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

23. Design the forward, reverse, and internal primers to the gene below and mutate the bolded/underlined histidine (CAC) to an alanine (GCC). Primers are usually 18-25 nucleotides long, but only make primers 9 nucleotides long to save work. 5'-ATGGATCGATACGGACGAAATCACCTACCGAATCAGGCGTGACGTGA-3' External Forward: External Reverse: Internal Forward: Internal Reverse:
You have the following DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG GTA ATT GGG GAA CGC GCG CGG TAA-3’ 1. For the second, third, fourth, and fifth codons, write all possible anticodon sequences (left-to-right, 5’- 3’), including anticodons with wobble and inosine.
• The image shows the sequence of tandem repetitive DNA (highlighted in green) at one locus in the genome, with the copy of the locus on each chromosome within the homologous pair shown (and listed as #1 and #2). Answer the following questions. 。 What type of repetitive DNA is shown? [Select] • You want to do a PCR of this locus. If one primer's sequence is 5'-TCGAGGTTC-3', then what is the second primer sequence needed to accurately PCR the locus? Choose a primer of 9 bases long. [Select] 。 You follow the PCR with an agarose gel electrophoresis. When preparing for agarose gel electrophoresis, which electrode should be placed nearest the starting point of the sample (the product of the PCR)? [Select] 。 Which allele would travel less far in your gel? [Select] #1: 5'-TCGAGGTTCCAACAACAACAACAACAACAACAACAACAAGGATCTACT-3' 3'-AGCTCCAAGGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTCCTAGATGA-5' #2: 5'-TCGAGGTTCCAACAACAACAACAACAACAACAACAACAACAACAACAACAAGGATCTACT-3'…
Consider the following coding sequence transcribed from 5' to 3'5' A T G A A G C G C T C A G T A 3' If a guanine is substituted for nucleotide 11 what type of base substitution has occurred (nucleotide level) and what would be the resulting phenotypic effect?
2. Consider the following DNA molecule. Assume this is the DNA sequence of the entire chromosomes. Assume there are no introns. 3' AATTAGCAGATGCATGATGCAATTACTAGCATGTAAGTA 5' 5' TПААТСGTТСТАСGTACTАCGTTAATGATCGTACATTCAT 3' Based on your knowledge of open reading frames, list the amino acid sequences of the possible protein or proteins that could be produced from this DNA sequence. You may use any codon table of your liking to complete the work. a. b. Suppose there was a sister chromatid generated from the chromosome sequence shown above. What would be its DNA sequence (provide the sequence in the space below. Be sure to identify the 5' and 3'ends)?
Please asap
When comparing evolutionary similarities between different genes within a gene family, it is usually more straightforward to compare genes by using the protein sequences of gene products rather than DNA sequences of the genes themselves. Explain why this is the case. (Cover 4 points)
1. Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg a) What are the first eight amino acids for each of these five DNA sequences?
. The physicist Stephen Hawking, famous for his theories about black holes, has lived past the age of 70 withamyotrophic lateral sclerosis (ALS), a paralyzing neurodegenerative disease that is usually fatal at a muchyounger age. Recently, geneticists discovered that amajor cause of ALS is the unusual expansion of ahexanucleotide repeat (5′-GGGGCC-3′) that lieswithin a gene called C9ORF72, at a location outside ofthe gene’s open reading frame (ORF). A single expanded allele is sufficient to cause ALS, but the reasonthe disease allele is dominant remains unclear. Someexperimental results support the theory that the allelemakes a toxic RNA containing the expanded repeat. Ifthis theory is correct, in what ways is the mutant ALScausing allele similar to the mutant allele that causesHuntington disease? In what ways is it similar to themutant allele that causes fragile X syndrome?
1. Let s and s' be two sequences, where s = GGATT and s' evolves from s by substituting the A in s by a C, and then appending AT to the end of s. • What is s'? • What is the true pairwise alignment of s and s'?
. In examining Figure 3-19, what do you think is the mainreason for the difference in size of yeast and humanmtDNA?
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…