Q: Don't use Ai. Answer in step by step with explanation.
A: Detailed explanation: :Step 1: Understanding the QuestionThe question states: "In teaching labs, we…
Q: Where in the meiosis process does independent assortment happen?
A: Meiosis is a type of cell division that results in four daughter cells each with half the number of…
Q: 1. Consider the following reaction of 1 to 2 below OH cat. HA 2 a. Draw a specific acid-catalyzed…
A: c.Acetic acid is more likely to exhibit a general acid mechanism than HCl.Explanation: Acetic acid…
Q: Why shouldn't electronic health records be made available to current or potential employers? Include…
A: Electronic Health Records (EHRs) are digital versions of patients' paper charts. They contain all…
Q: Identify the structures on the Amoeba. C. Identify the structure labeled A Identify the structure…
A: Nucleus (Arrow A):The nucleus is a crucial organelle found in eukaryotic cells. It serves as the…
Q: Use this information to answer the following 2 questions. Individuals from different age groups…
A: First, let's understand the data given. The data is about the average hours of sleep individuals get…
Q: Help placing labels in correct column
A: Silent Mutation: A change in the DNA sequence that does not change the amino acid sequence of the…
Q: How do I calculate the Variance , mean and standard deviation from this table?
A: : Step 2: Step 3: Step 4:
Q: In sponges that live in calm water, flow velocity increases considerably after leaving the…
A: In sponges that live in calm water, the water flow velocity significantly increases after leaving…
Q: I WILL GIVE DISLIKES!!! IF ANYTHING WRONG HAPPENS IN MY QUESTION, BETTER SKIP IT!!!! መፍትሄውን እና…
A: Approach to solving the question: Detailed explanation:1. Cells Responsible for Storing…
Q: ✓ [Select] Sugar and phosphate Sugar and nitrogenous base Phosphate and nitrogenous base d together…
A: Sugar and phosphate molecules alternate to form the backbone of a single strand of DNA or RNA.The…
Q: None
A: The matches for the given question Promotes colon health:Nonfermentable fiber increases stool bulk…
Q: (a) Give one reasons why you would want to use the Library databases to search for primary research…
A: Library databases are preferred over general internet searches for several reasons when conducting…
Q: Draw , label adiagram of ligustrum leaf (internal)and describe it's structures and adaptation
A: Solution:Structures of the Ligustrum Leaf:Cuticle: Thin, waxy, impermeable layer lying over both the…
Q: What would happen if X and Y engage in genetic recombination that happens in a region of Y that…
A: The SRY gene, also known as the sex-determining region Y gene, is a gene on the Y chromosome in…
Q: How does ancestry and race play into disease genetics?
A: Disease genetics refers to the study of how genetic variations contribute to the development of…
Q: please help thank you so much
A: Approach to solving the question: Detailed explanation:PhagocytosisPhagocytosis is a form of…
Q: Use the following to respond to the three questions posed below: The XX proband exhibits the…
A: 1) To construct a pedigree for this family, we'll map out the inheritance pattern based on the…
Q: Don't use Ai. Answer in step by step with explanation.
A:
Q: How does insomnia occur through menopause?
A: Menopause is a natural biological process that marks the end of a woman's menstrual cycles. It is…
Q: I missed out many marks and don't know why. I would like to see how experts anwer so I can compare…
A: ### Exercise 2: Effect of CO2 on Blood pH and Exercise Impact**Question 2(a):** *Time it took for…
Q: None
A: Here is the matching of each aspect of transcription or translation with the appropriate motif,…
Q: QUESTION 1'Descent with modification' is a phrase that best describes, which of the following?O…
A: Detailed explanation:1. Natural SelectionDefinition: Natural selection is a process where organisms…
Q: Give two reasons why most freshwater invertebrates are either hermaphroditic or utilize internal…
A: Key references:Levitan, D. R. (2020). The ecology of fertilization in free-spawning invertebrates.…
Q: Describe three changes in cell cycle control and regulatory proteins that lead to cancer.
A: Key references:Boutelle, A. M., & Attardi, L. D. (2021). p53 and tumor suppression: it takes a…
Q: A pathogenesis function f(t)t(t-21)(t + 1) is used to model the development of the disease, where t…
A:
Q: I cannot understand meaning of adjacent cells and also struggling with drawing annotation. May I see…
A: Explanation In the context of cardiac muscle cells, adjacent cells are those that are lined up side…
Q: (a) Outline the primary categories of microorganisms found in the microbial world. (b) Discuss the…
A: Refer to the solution
Q: You bought cold cut slices of turkey breast with a label of "no nitrites or nitratesbut contains…
A: Food intolerance and food allergy are two different types of reactions that the body can have to…
Q: consider a muscle cell is changing from relaxation to contraction 1)Is the length of the…
A: Understanding SarcomeresStructure of SarcomeresSarcomeres are the smallest functional units of…
Q: EKSAMENVRAE: MIKRO-ORGANISMES 1888 A Meervoudige keusevrae Eenheid 3 Vier moontlike antwoorde word…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: Question: The postdoc in the lab gives you two samples: one is the Gram-positive B. anthracis and…
A: Approach to solving the question: Detailed explanation:When comparing the Gram-positive…
Q: Answer in step by step with explanation. Don't use Ai and chatgpt.
A: Step 1: Step 2: Step 3: Step 4:
Q: Classification/Phylogeny Review-Practice Part 2 to divider Review Questions (you may continue your…
A: Approach to solving the question: Slide 1: Title SlideTitle: Phylogeny and Classification…
Q: Which of the following are true statements about fungal spores? Select all that apply. They are…
A: Fungal spores serve as a reproductive unit for fungi, allowing them to reproduce both sexually and…
Q: If I'm given this information and I am told that the average estimated heritability was determined…
A: Approach to solving the question: Here's a step-by-step approach you can take:Collect Historical…
Q: Course Code: BIO121 Course Name: Principles of Biology I Read the question carefully first Answer…
A: The lock and key model is a simplified explanation of how enzymes work. In this model, the enzyme…
Q: A The chromosomes of a particular individual were examined and were found to consist of the ff.:…
A: Here's a detailed explanation: 1. Reciprocal translocation:This is a type of chromosomal aberration…
Q: None
A: Osmosis:Osmosis is the movement of water molecules through a selectively permeable membrane from an…
Q: Watch this brief video section on a researcher discussing the experimental design for a cancer…
A: This study is meant to answer a research question on the efficacy of a new cancer vaccination in…
Q: Do not use Ai
A:
Q: In the prevention of bacterial growth inside stored or canned food, salt and sugar act as or by:…
A: Salt and sugar are commonly used in food preservation, including in the storage and canning of food.…
Q: What is the purpose of human heart?
A: Key references:Farrell, A. P., & Jones, D. R. (2023). The heart. In Fish physiology (Vol. 40,…
Q: Answer in step by step with explanation. Don't use Ai and chatgpt
A: The H gene controls the presence of the ABH antigen in the red blood cell and it codes for…
Q: Course Code: BIO-121 Chapter 3: Molecules of Life (A) Complete the tables below: Polymer…
A: The monomer subunit of the polymer polysaccharides is a simple sugar, also known as a…
Q: What is the probability that III-j has Huntington's?
A: To solve this problem, we need to calculate the probability that individual III-j in the pedigree…
Q: Please help
A: The molecule depicted in the image is adenosine triphosphate (ATP), which serves as the precursor…
Q: *Points will be deducted for blank boxes (except for the Notes section unless there is a specific…
A: 1. Creatine Kinase (CK)Physiologic Action: Creatine kinase (CK) plays a crucial role in energy…
Q: Do not use chatgpt.
A: Physical Appearance of both plants:Aloe vera:Leaves: Aloe vera plants have thick, fleshy leaves that…
Q: 10) Two pure-breeding phlox plants were crossed, one with dark-blue flowers and the other with pinl…
A: The F2 generation from the initial cross produced four phenotypes: dark-blue, light-blue, red, and…
1.) What process is shown here?
2.) Label the structures- components that the arrows are pointing to on the diagram.
Step by step
Solved in 2 steps with 1 images
- hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'Draw the peptide at a pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr - do it on this formatSspI --- 5' AAT - ATT 3'5' GGATAATATT GTTAACAATCTCTACGGGTTAACACCCTTGGAATATTTTAA 3' 3' CCTATTATAACAATTGTTAGAGATGCCCAATTGTGGGAACCTTATAAAATT 5' Number of pieces of DNA _______
- 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 --+---- 70 3′-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTCACATTACAAACGGATTCCGG -5' 1 11 -#- -+-- +-- a) Draw a green box around the promoter. b) Label the template strand of the DNA on the sequence above. --+-- -+ c) Write the sequence of the pre-mRNA. d) This gene has a small intron and the intron splice sites has the composition 5'-GUG-3' (for the 5' splice site) and 5'-UUG-3' (for the 3' splice site), meaning that these sequences and everything between them will be removed from the mature mRNA. -Draw a box around the intron on the DNA sequence above. e) Write the sequence of the peptide that is translated from the mature mRNA and label the directionality of the peptide. f) Imagine that, in the process of DNA replication, the 39th base in the gene (with the *) was changed from A/T to C/G. What would be the effect of this mutation on the produced peptide?Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile – Tyr – Lys – Asp mRNA sequence (5’-3’)AUG – AAC – UGU – UUU – GAA – AUG – CUU – CGU – AUU – GAU – GAA – GGU – CUU – CGU – CUU – AAA – AUU – UAU – AAA – GAU - Write the dsDNA that encodes for this peptideGENE G DNA GTCGTCTII MRNA Amino Acid
- Genetic Code-Reference Second Letter First Letter C Third Letter UAU] UACS **UAA Stop UGU] Cys UGC U UUU Phe UUC UCU Туг UCC U Ser UUA) Leu UUG **UGA Stop UGG Trp UCA UCG **UAG Stop CUU CCU CAU) CGU His CACJ CAA) CUC CCC CGC Leu Pro Arg CUA ССА CGA A Gln CUG CCG CAGJ CGG AAU] AGUSer U AUU ACU AACAsn AAA Lys AUC Ile ACC AGC C Thr AGA] Arg AUA ACА AAGJLYS GAU] GACASP *AUG Met/Start ACG AGG U GUU GCU GGU Asp GUC GCC GGC Val Ala Gly GAA) Glu GAGJ GUA GCA GGA GUG GCG GGGPlease answer all the questions as soon as possibleUCA CAG AAA CUG How many amino acids does the mRNA strand above code for?
- Second letter A UUU UCU) UC UCA UCG UAU UUC Phe UUA Tyr UGU UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CAUHIS CUU CUC CUA CUG CCU* C ССА CCG CGU His САС Leu CGC Arg CGA Pro CAA Gin CGGJ Gln Which amino acid is carried by the TRNA with the anticodon 5'-UCA-3? ACU ACC ACA AAU AAC. AGU AGC AGA AUU Ser Asn AUC Ile A AUA Thr AAA Lys AAG Lys AGG Arg AUG Met ACG GAU GGU] GUU GUC GUA GUGJ GCU GCC GCA GCG GAC Asp Ala GAA GGC Gly GGA Val GAG Glu GGGJ Isoleucine. None-this is a stop codon. Aspartic acid. Histidine. IV. Leucine O V. Third letter UCAG UCAG UCAG First letterGENE C DNA AGCAGG MRNA Amino Acidposition position (5' end) position (3' end) UUU Phe - F UUC Phe UAU Tyr Y. UAC Tyr UAA Stop UGU Cys UGC Cys UGA Stop UGG Trp UCU Ser UCC Ser U UUA Leu UUG Leu UCA Ser UCG Ser UAG Stop W 輔 CAU His CGU Arg CGC Arg CGA Arg CGG Arg CUU Leu CCU Pro CUC Leu CCC Pro P. CCA Pro CÁC His CỦA Leu CAA Gln CUG Leu CCG Pro CAG GIn AUU lle ACU Thr AAU Asn AGU Ser AUC lle ACC Thr -T ACA Thr AAC Asn_ AGC Ser AGA Arg AGG Arg A AUA lle AAA Lys EK AAG Lys AUG Met ACG Thr GUU Val GGU Gly GGC Gly GGA Gly GGG Gly GAU Asp D GAC Asp GCU Ala GUC Val -V GUA Val GCC Ala GCA Ala GCG Ala G - A GAA Glu FE GAG Glu GUG Val Nonpolar Polar Basic Acidic Stop codon Table 4.1 Biology: How Life Works, Third Edition © 2019 W. H. Freeman and Company Consider the DNA sequence–3'-CACTGGTAGCGA–5', • What is the sequence of the messenger RNA sequence that is transcribed from this DNA sequence? (Indicate the 5' and 3' ends of the RNA molecule.) • Consult the genetic code that is shown above. What is the amino acid sequence of the…