The next 4 questions refer to the figure below. The image below represents a protein-coding gene containing 6 exons (1/2, 3, 4, 5, 6, and 7/8). This gene is transcribed and spliced and further processed in the cell to generate all the transcripts represented below, enumerated with the circled-numbers 1 through 9. The different conventions used in relation to the different components of the transcripts are shown on the left. : • 5' cap : CDS (coding sequence) Non-coding sequence (A) 250 : Poly-A tail (A) @ B(A) 250 5 b 8(A) 250 STOP 2345 a 8 (A) 250 STOP : Stop en chien ⑤ 345 b 8 (A) 250 STOP STOP

The next 4 questions refer to the figure below. The image below represents a protein-coding gene containing 6 exons (1/2, 3, 4, 5, 6, and 7/8). This gene is transcribed and spliced and further processed in the cell to generate all the transcripts represented below, enumerated with the circled-numbers 1 through 9. The different conventions used in relation to the different components of the transcripts are shown on the left. : • 5' cap : CDS (coding sequence) Non-coding sequence (A) 250 : Poly-A tail (A) @ B(A) 250 5 b 8(A) 250 STOP 2345 a 8 (A) 250 STOP : Stop en chien ⑤ 345 b 8 (A) 250 STOP STOP

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.
The following four mutations have been discovered in a gene that has more than 60 exons and encodes a very large protein of 2532 amino acids. Indicate which mutation would likely cause a detectable change in the size of the mRNA and/or the size of the protein product. Consider a detectable change to be >10% of the wild-type size. A table of the genetic code is shown below. First letter 0 00 U O A บบบ UUC UUA UUG U CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu >Leu AUU AUC lle AUA AUG Met >Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala CAU CAC CAA CAG UAU UGU Tyr UAC UGC UAA Stop UGA UAG Stop UGG AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGGJ AGU AGC AGA AGG GGU GGC GGA GGG O AAG576UAG (changes codon 576 from AAG to UAG) Cys Stop Trp O GUG326AUG (changes codon 326 from GUG to AUG) Arg Ser Arg Gly DUAG DUA G DCAG DO AG deletion of codon 779 insertion of 1000 base pairs into the sixth intron (this particular…
Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 1 Glu Ile 3 Stop Ile 4.
In the text box below, answer the following questions. Remember to label your answers that correspond to the questions, and attempt answering all of the questions to receive full credit. 1. Use the table of the genetic code to complete the following table. The columns represent transcriptional and translational alignments. Label the 5' and 3' ends of DNA and RNA, as well as the amino (N) and carboxyl (C) ends of the protein. end end DNA double G A helix 3' CA U MRNA transcribed G C A TRNA anticodon Trp Amino acid
Which of these epigenetic changes could lead to reduced transcription of a particular gene? Please make sure to select all correct answer options. decreasing acetylation of histones associated with the nucleosomes of that gene inducing histone modifications that allow the formation of denser nucleosomes in the regulatory region of the gene Oincreasing acetylation of histones associated with the nucleosomes of that gene repositioning the nucleosomes associated to the gene to expose the enhancer and promoter DNA of the gene Uremoving histones to expose the enhancer and promoter DNA of the gene
Read the images attached before answering the following question. Explain the meaning of the numbers and letter in the chromosomal location for gene A.
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
Can I please have help with this question,thank you!
Please answer iv and v as the first three have been answered.
The line below represents a mature eukaryotic mRNA. The accompanying list contains many sequences or structures that may or may not be a part of mature eukaryotic mRNA. As accurately as you can, show the location, on the line, of the sequences or structures that belong on the eukaryotic mRNA; then separately list the items that are not part of eukaryotic mature mRNA. 5’____________________________________________________3’ A-stop codon B-poly-A tail C- intron D- 3’UTR E-promoter F- start codon G- AAUAAA H- 5’ UTR I- 5’ cap J- Termination sequence
"Kindly answer this and make an explanation. That will be my reviewer."
NOTE THIS: DECODE IT PLEASE JUST PROVIDE A BRIEF ANSWER. PLEASE HELPE OUT, I'M BEGGING YOU PLEASE. THANK YOU SO MUCH IN ADVANCE.