The next 4 questions refer to the figure below. The image below represents a protein-coding gene containing 6 exons (1/2, 3, 4, 5, 6, and 7/8). This gene is transcribed and spliced and further processed in the cell to generate all the transcripts represented below, enumerated with the circled-numbers 1 through 9. The different conventions used in relation to the different components of the transcripts are shown on the left. : • 5' cap : CDS (coding sequence) Non-coding sequence (A) 250 : Poly-A tail (A) @ B(A) 250 5 b 8(A) 250 STOP 2345 a 8 (A) 250 STOP : Stop en chien ⑤ 345 b 8 (A) 250 STOP STOP

The next 4 questions refer to the figure below. The image below represents a protein-coding gene containing 6 exons (1/2, 3, 4, 5, 6, and 7/8). This gene is transcribed and spliced and further processed in the cell to generate all the transcripts represented below, enumerated with the circled-numbers 1 through 9. The different conventions used in relation to the different components of the transcripts are shown on the left. : • 5' cap : CDS (coding sequence) Non-coding sequence (A) 250 : Poly-A tail (A) @ B(A) 250 5 b 8(A) 250 STOP 2345 a 8 (A) 250 STOP : Stop en chien ⑤ 345 b 8 (A) 250 STOP STOP

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.
You are studying a gene containing three exons (exon 1 = 66 nucleotides , exon 2 = 99 nucleotides , and exon 3 = 333 nucleotides ) that produces a primary RNA transcript 748 nucleotides long . Gel electrophoresis analysis shows different size mature transcripts are produced in three different cell types . The sizes of the mature transcripts are the following : 1. Neuronal nalcells = 498 nucleotides 2. Muscle cells = 600 nucleotides 3. Liver cells = 399nu nucleotides Primary RNA ranscript = 748 nucleotides a. Name the strategy that allows the same gene to produce different mature transcripts in different tissues . b. Describe the ways (or combinations of exons /introns ) used to produce each one ofthe three mature transcripts . Label the each mature transcripts and include its length . c. Indicate the length of the polypeptide encoded by each mature transcript
Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________
In this section, please change the underlined portion to make the statement TRUE. Please note: this is different from how True/False questions have been done previously, where you had to indicate whether the statement was true or false. For this exam, please assume that all statements are false, and correct the underlined portion to make the statement true. Question 48 During MRNA splicing, U2 binds to the 3' splice site. Blank # 1 Blank # 2 Question 49 The loss of electrons from an atom is called reduction. Blank # 1 Blank # 2
The following four mutations have been discovered in a gene that has more than 60 exons and encodes a very large protein of 2532 amino acids. Indicate which mutation would likely cause a detectable change in the size of the mRNA and/or the size of the protein product. Consider a detectable change to be >10% of the wild-type size. A table of the genetic code is shown below. First letter 0 00 U O A บบบ UUC UUA UUG U CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu >Leu AUU AUC lle AUA AUG Met >Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala CAU CAC CAA CAG UAU UGU Tyr UAC UGC UAA Stop UGA UAG Stop UGG AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGGJ AGU AGC AGA AGG GGU GGC GGA GGG O AAG576UAG (changes codon 576 from AAG to UAG) Cys Stop Trp O GUG326AUG (changes codon 326 from GUG to AUG) Arg Ser Arg Gly DUAG DUA G DCAG DO AG deletion of codon 779 insertion of 1000 base pairs into the sixth intron (this particular…
Please complete all parts of the question
Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 1 Glu Ile 3 Stop Ile 4.
In the text box below, answer the following questions. Remember to label your answers that correspond to the questions, and attempt answering all of the questions to receive full credit. 1. Use the table of the genetic code to complete the following table. The columns represent transcriptional and translational alignments. Label the 5' and 3' ends of DNA and RNA, as well as the amino (N) and carboxyl (C) ends of the protein. end end DNA double G A helix 3' CA U MRNA transcribed G C A TRNA anticodon Trp Amino acid
Which of these epigenetic changes could lead to reduced transcription of a particular gene? Please make sure to select all correct answer options. decreasing acetylation of histones associated with the nucleosomes of that gene inducing histone modifications that allow the formation of denser nucleosomes in the regulatory region of the gene Oincreasing acetylation of histones associated with the nucleosomes of that gene repositioning the nucleosomes associated to the gene to expose the enhancer and promoter DNA of the gene Uremoving histones to expose the enhancer and promoter DNA of the gene
Are these true or false answers correct? If so, what is the proper word to replace the underlined words, for the false.
Read the images attached before answering the following question. Explain the meaning of the numbers and letter in the chromosomal location for gene A.
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.