Describe the changes that occur in each step of the mechanism.
Q: Prostaglandins are a class of cicosanoids, fatty acid derivatives with a variety of extremely potent…
A: Vmax and Km of an enzyme in the presence and absence of inhibitor can be determined by using a…
Q: Answer in brief sentences in your own words please thank you! 1. Soon after the bolus reaches the…
A: Starch is a complex carbohydrate. Starch digestion starts in the mouth but occurs mostly in the…
Q: 1. I Draw the amino acids Asn and His and show the most prevalent interaction that would occur…
A: Amino acids are biomolecules with an amino group, a carboxyl group and a side group linked to the…
Q: Which of the following which of the following reactions is an endergonic reaction that could…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: Beta subunit of ATP synthase is currently in its loose state. At what phase of ATP synthesis is it…
A: ATP synthase is an enzyme belongs to the class of ligases which catalyzes the formation of ATP from…
Q: Process: State (at right)
A: The cell membrane is composed of a phospholipid bilayer. The proteins embedded in the membrane (…
Q: The highest level of structural complexity completely retained by the molten globule state of a…
A: The term "molten globule state of a protein "refers to the diverse types of partially-folded protein…
Q: A competitive inhibitor interacts with the free enzyme to form an enzyme•inhibitor complex (E•I).…
A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…
Q: How many reduced molecules (NADH, FADH2, NADPH) will be generated by converting lineoleic acid…
A: The fats are stored in eukaryotes as triglycerides that are broken down using the enzyme Lipase to…
Q: The steady-state kinetics of an enzyme are studied in the absence and presence of an inhibitor B…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: Indicate whether each of the following descriptions concerning the molecule sphingosine is true or…
A: Phospholipids are compound lipids composed of fatty acids, alcohol, phosphate group, and nitrogenous…
Q: Fructose 1,6-bisphosphatase (FBPase) is a key enzyme in gluconeogenesis. The mammalian enzyme is…
A: Gluconeogenesis is a process in which glucose is synthesize from non-carbohydrate sources like…
Q: How many reduced molecules (NADH, FADH2, NADPH) will be generated by converting linoleic acid…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: single-substrate reaction E+SESE+P.7 nditions: [S] > Km- ent with the condition that it describes.…
A: .
Q: Which of the following peptides is most likely to serve as a signal sequence in human tissues a.)…
A: Peptides are polymers of amino acid residues linked via a peptide bond. Amino acids are…
Q: Name three metabolic processes in the cell that are enhanced and two that are inhibited in response…
A: Insulin is a peptide hormone released by the beta cells of the pancreas. The key function of insulin…
Q: 1. The enzyme you are studying uses the substrate pictured at right. An inhibitor box in the freezer…
A: Enzyme inhibition is when a inhibitor bind to the enzyme at the active site or another site, which…
Q: Search the protein data bank (https://www.rcsb.org/)and find an image of one protein that is found…
A: The SARS-CoV-2 virus is the infectious disease known as coronavirus disease (COVID-19). A group of…
Q: The Hb Yakima variation is caused by the mutation D99H, which results in a shift in oxygen binding…
A: Hemoglobin binds to oxygen and it appears in two state. The T state (tensed) and R state (relaxed).…
Q: Consider the reaction coordinate diagram shown below. X is is ;Y
A: The above shown diagram is a reaction coordinate diagram. The free energy of the system is plotted…
Q: Arrange the events of replication chronologically from A (first) to G (last event): -Sealing of…
A: Replication is the process in which duplication of DNA takes place inside the nucleus. this process…
Q: Sketch the graph for velocity v.s. substrate concentration for enzyme 1 and enzyme 2. They have…
A: Vmax is the maximal velocity that a reaction can reach when all the enzyme molecules are saturated…
Q: Identify the biochemical role that each plays within a biochemical transformation:…
A: Coenzymes and cofactors are non protein components that are essential for a protein function. Most…
Q: 16-24 epiners are encintomers. Draw Haworth projection a) b) When the molecule formulas for dímers…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: 1. What is the possible identity of the amino acid? [ Select] V 2. What is the isoelectric point of…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…
Q: explain adenocarcinoma and carcinoid tumors in detail Provide examples.
A: Cancer is deadly disease in which cells of body grow uncontrollably and spread to different parts of…
Q: ue about the Golgi Complex EXCEPT A number of stacks of differing compositions make up the…
A: Golgi apparatus or Golgi complex is a cytoplasmic organelle of smooth membrane sacs or cisternae.…
Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.
A: Catabolism is one is the steps of metabolism in which complex compounds are hydrolysed into simpler…
Q: Refer to the chromatograph (Figure 1) below and answer the questions that follow: What is the…
A: Affinity chromatography is a separation technique that takes advantage of the ligand specificity…
Q: Which statement is false for transition-state analog enzyme inhibitors? They fit the active site…
A: Transition state analogues are used as enzyme inhibitors. They bind competitively to the active site…
Q: The beta-pleated sheets are stabilized by hydrogen bonds among adjacent regions of the peptide…
A: Introduction Protein is the most abundant macromolecule in our body. proteins are made up of carbon,…
Q: Yeast cells are grown with galactose as the sole carbon source and ATP levels are abundant. Describe…
A: GAL genes: The GAL genes, which include structural (GAL1, GAL10, GAL2, and GAL7) and regulatory…
Q: Which of the following statements is true regarding the classification of amino acids? Group of…
A: Amino acids the building block of polypeptide chain, the alpha carbon of amino acids contains -…
Q: PEP and 2-PG have similar amounts of potential metabolic energy with respect to decomposition to Pi,…
A: Glycolysis occurs in the cytoplasm of the cell. Glycolysis converts glucose into two molecules of…
Q: Relate the molecular properties to physicochemical properties of the following lauric acid stearic…
A: Lipids are chemically diverse group of biomolecules that have two common properties: they are…
Q: Consider the each of the amino acids in the peptide below.…
A: Amino Acids: Although the liver is the primary location for amino acid metabolism, other organs…
Q: In most enzymes, the required active site amino acids consists of only a few residues. Why is the…
A: Enzymes are proteins that function as biocatalysts and catalyse biochemical reactions.They have a…
Q: In a Myoglobin and azide ligand-receptor binding experiment, instead of using 3.5 µM myoglobin you…
A: Myoglobin acts as oxygen reserve in the muscle cells. Myoglobin (Mb) has higher affinity towards…
Q: result of other cligestive enzymes for chemical chgestion like try pon, which are not as acidic a…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. The activity of…
Q: Explain IN DETAIL the process of glycolysis. Include the overall equation, location products,…
A: Introduction Glycolysis is a process by which glucose breaks down to produce pyruvate and energy.…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: If you wanted to improve the catalytic efficiency of an enzyme, would you mutate amino acid residues…
A: In the transition state, a molecule is neither a substrate nor a product. This state exists at the…
Q: Glyceraldehyde-3-phosphate + NAD+ + Pi → 1,3-bisphosphoglycerate + NADH + H+ ∆G0’ =+6.3 kJ…
A: In a general reaction such as: aA + bB ⇌ cC + dD The free energy changes in chemical reactions are…
Q: . The book dived into allosteric enzymes and how they are regulated in metabolic pathways, but…
A: Michaelis Menten enzymes are those that follow MM kinetics. These enzymes have their reaction rates…
Q: A.Provide the name for the D-monosaccharide “1” in the above image. You may ignore the alpha or…
A: There are four classes of biological macromolecule: nucleic acids, proteins, lipids and…
Q: The enzymatic activity of PFK1 is generally measured by set- ting up a coupled enzyme assay system…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…
Q: Cyt cb562 will form a tetramer in the presence of Zn+2 or in the absence of Zn+2, it will form a…
A: INTRODUCTION : Cyt cb562 - Cytochrome cb562 is a variant of an Escherichia coli four-helix bundle…
Q: What is the hydrodynamic stress of bioreactors when there are cell cultures?
A: Introduction A bioreactor is a vessel or manufactured device which gives biologically active…
Q: *Write structures for the straight-chain (Fischer projection) formula and the indicated anomer of…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Consider the oxidation of a molecule of MANNOSE. (Put the numerical values in the answer boxes.) •…
A: Mannose is a carbohydrate that is composed of carbon, hydrogen, and oxygen in a ratio of 1:2:1.…
Describe the changes that occur in each step of the mechanism.
Step by step
Solved in 2 steps
- . The following diagram shows the biosynthesis of B12 coenzymes, starting with the vitamin. DMB is dimethylbenzimidazole. (a) What one additional substrate or cofactor is required by enzyme B? (b) Genetic deficiency in animals of enzyme C would result in exces- sive urinary excretion of what compound?You are working on an enzyme that obeys standard Michaelis-Menten kinetics. What variable is the V, dependant on if the concentration of the substrate is substantially higher than the concentration of the enzyme? [S] [E] [ES] O [P] O not enough information provided1. Please fully explain (use illustrate where appropriate) the Modes of Enzyme Catalysis exemplified by the serine protease: Chymotrypsin. In your answer discuss employing the illustration whenever possible: the overall reaction mechanism, stability of the reaction transition state, proximity and orientation effects, acid-base catalysis, and covalent catalysis. (c) (0) Ap Asp Toe His Asp 10 C-N bond cleavage HN Ho Ser Ger Binding of substi 196 Ser Gly alto video LBHB NH Sere HAR Proton donation by H (h) Fel of amino product yest OHN Hig Ser Ap (0) Formation of covalent (ES) Alp Me complex Serios
- A synthetic substrate, the para-nitrophenylacetate (PNPA), is used to monitor enzyme activity of protein P. The product of the hydrolysis reaction absorbs at 410 nm with a molar extinction coefficient of 4 000 M-¹.cm-¹. 1- Write the reaction catalyzed by the protease P using the pNPA substrate. 2- The enzyme extract is too concentrated and a 1/300 dilution is needed for enzyme tests. Considering that you would need at least 600 µL of diluted enzyme extract for activity tests, indicate which volume of buffer and enzyme extract you must use for the dilution.Asp residue (both of which are essential for catalysis) with pK, values of 5.9 and 4.5, respectively. If the enzyme is found in the lysosome (pH = 5.2), which residue will act as the general acid and which will act as the general base during the initial steps of the reaction? Explain your reasoning. (The KMof the enzyme for the substrate adenosine is 3 × 10ꟷ5M. The product inosine acts as an inhibitor of the reaction, with an inhibition constant (KI, the dissociation constant for enzyme-inhibitor binding) of 3 × 10ꟷ4M. However, a transition state analog,Inhibits the reaction with KIof 1.5 × 10ꟷ13M. Explain why 1,6-dihydroinosine serves as a better inhibitor of adenosine deaminase than inosine. Elaborate on your answe
- I2 An immobilized enzyme plug flow reactor (PFR) contains a very porous honeycomb structure that has an enzyme immobilized on its surface. The substrate (S) enters the reactor at a concentration of 0.05 mole L-1along with an uncompetitive inhibitor (I) with a concentration of 0.01 mole L-1. The enzyme properties are such that: Vmax= 1.2 x 10-8mole cm-2sec-1, Km= 0.12 mole L-1. For the inhibitor KI= 0.05 mole L-1. The flowrate through the reactor is such that kL= 10-4cm sec-1. The surface area to volume ratio of the honeycomb structure in the bioreactor is 1 cm-1. Estimate the residence time needed to achieve a 90 % conversion of the substrate. If the flowrate through the reactor is 100 L hr-1, what is the total volume (L) of the reactor needed to achieve this conversion? If the L/D ratio of the reactor is 10, what are the dimensions (ft) of the reactor? Repeat these calculations if external mass transfer effects are ignored.Diagram the hydrogen-bonding interactions of the catalytic triad His–Lys–Ser during catalysis in a hypothetical hydrolytic enzyme.Chart is Given for you: Below is a chart of values for actual enzymes. Enzyme Km (M) kcat (1/s)Chymotrypsin 1.5 × 10^−2 0.14Pepsin 3.0 × 10^−4 0.5Tyrosyl-tRNA synthetase 9.0 × 10^−4 7.6Ribonuclease 7.9 × 10^−3 7.9 × 10^2Carbonic anhydrase 2.6 × 10^−2 4.0 × 10^5Fumarase 5.0 × 10^−6 8.0 × 10^2 Assume the enzyme concentration is equal across all samples (and is equal to 1). (Answer a and b only)a. Which enzyme will have the highest V0 at very high substrate concentrations? (1 M). Why? b. Which will have the highest V0 at very low substrate concentrations (5.0 × 10^−12). Why?
- KINETIC CONSTANT No Na2HPO4 25mM Na2HPO4 50mM Na2HPO4 Vmax nmol p-NP. Min- 20.3252 14.30615 17.30104 Km mM -0.819106 -0.46495 -0.352941 1. What does this suggest about the structure of the active side of the enzyme?a What would be the appropriate name for an enzyme that catalyzes each of the following reactions: b H3C iOH OH NH₂ alanine ligase alanine oxidoreductase alanine isomerase alanine transferase OH H3C CH3 H3C NO₂ propanone transferase propan-2-ol hydrolase propan-2-ol oxidoreductase propan-2-ol isomerase OH H3C CH3(i) Describe the mechanism of chymotrypsin in cleaving a peptide bond, highlighting the roles of the catalytice triad for the two phases of the catalytic reactions. Explain the significance of the oxyanion hole for the catalysis. (ii) All serine proteases contain the catalytic triad and these amino acids are positioned in the exact same conformation. Since this is true, why do trypsin and chymotrypsin have such different substrate specificity? What features of the enzyme allow for this situation?